Overview

Comprehensive Description

Biology

More common in rivers than lakes; feeds on insects, crustaceans, fish, vegetation and debris (Ref. 28714). Considering the distribution of different forms (according to collection determinations), it should be noted that a B. macrolepidotus 'form' is found only in northern regions, while a B. schoutedi 'form' is found only in southern regions. However, between these two forms there appears to be mixing and intermediacy of forms. We consider that there are several populations which have evolved in a geographical gradient to produce different morphotypes of a single species (Ref. 80290).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Brycinus macrolepidotus -

AMNH 240383, 6, 1 C&S;

  • Melanie L. J. Stiassny, Victor Mamonekene (2007): Micralestes (Characiformes, Alestidae) of the lower Congo River, with a description of a new species endemic to the lower Congo River rapids in the Democratic Republic of Congo. Zootaxa 1614, 17-29: 19-19, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:EFFDCA90-CD71-40DA-B0D1-5E2030D2D945
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Brycinus macrolepidotus occurs throughout most of inter-tropical Africa, but is absent from the Gambia basin.

Central Africa: This species is known from throughout the Congo River basin.

Eastern Africa: It is found in Lake Albert, Albert and Murchison Niles, and the Aswa River (This species is known from upper Nile system)

Northern Africa: This species is now extinct in northern Africa, although it used to be caught from This species is known from upper Nile, Egypt.

Northeast Africa: It is present in the Ghazal and Jebel systems, White and Blue Niles, Nile to Lake Nasser (also known as Lake Nubia). Also found in Tekeze, Setit in Eritrea, and Baro and Omo Rivers in Ethiopia

Western Africa: Known from Senegal, Niger, Chad, Volta and basins from Sierra Leone to Cameroon.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Africa: present throughout intertropical Africa (Ref. 2880, 80290, 81279). In Lower Guinea found from Cameroon to the Chiloango River basin (Ref. 80290). Absence from the Gambia basin is noteworthy (Ref. 81279). Present in the Nile system and the Zaïre [=Congo] basin (Ref. 5331).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Africa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Anal spines: 0; Analsoft rays: 13 - 19
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 530 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

53.0 cm SL (male/unsexed; (Ref. 2880)); max. published weight: 2,000 g (Ref. 3799)
  • Ita, E.O. 1984 Kainji (Nigeria). p. 43-103. In J.M. Kapetsky and T. Petr (eds.) Status of African reservoir fisheries. CIFA Tech. Pap. 10:326 p. (Ref. 3799)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Diagnosis: fronto-parietal fontanel absent in adults, sometimes pore-like in juveniles; snout long, comprimised 3x in head length; dorsal fin origin distinctly behind pelvic fin insertion; adults large-sized; no sexual dimorphism affecting anal fin shape; 21-31 lateral line scales; 4.5 scales between lateral line and dorsal fin; 10-16 anal fin branched rays; 14-22 gill rakers on lower limb of first gill arch; 8-14 teeth in outer premaxillary row (Ref. 2880, 80290, 81279). Head length/snout length 2.6-2.9; 10-12 predorsal scales (Ref. 80290). Body depth more than 3x SL in adults (Ref. 2880, 81279). Description: anal fin with 3 branched and 10-16 unbranched rays; 8-14 premaxillary teeth, two of which shift progressively backwards with growth; supraorbital bone well-developed; upper jaw projecting beyond lower jaw in adults (Ref. 2880, 80290, 81279). Coloration: humeral spot; black precaudal blotch extending partly unto median caudal-fin rays; greenish back, white belly; juveniles with white spot on upper part of caudal peduncle (Ref. 2880, 80290, 81279). Sides sometimes with an orange (Ref. 2880, 81279) or broad dark (Ref. 80290) longitudinal band from opercle to caudal fin in adults only. This color pattern is not correlated with sexual activity (Ref. 2880, 80290, 81279). In most fish fin color varies from red-orange or pink (Ref. 2880, 80290, 81279) to grey (Ref. 80290). In some populations fin margins are trimmed with dark pigment (Ref. 80920). Only live specimens from Cavally River (Côte d'Ivoire) have vermillion red fins (Ref. 2880, 81279).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

AMNH 240383, 6, 1 C&S;

License not applicable

Melanie L. J. Stiassny

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Brycinus macrolepidotus is potamodromous species, found more commonly in rivers than in lakes. It feeds on insects , crustaceans, small fish, vegetation and debris (Bailey 1994). It is a pelagic, potamodromous species (Riede 2004). The maximum published weight is 2000 g (Ita 1984). Spawning sites and season unknown.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

pelagic; potamodromous (Ref. 51243); freshwater; brackish
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 2 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 2 - 3

Graphical representation

Depth range (m): 2 - 3
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Potamodromous. Migrating within streams, migratory in rivers, e.g. Saliminus, Moxostoma, Labeo. Migrations should be cyclical and predictable and cover more than 100 km.
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Fish Species Associates in the Senegal River

There are 141 species of fish recorded in the Senegal River, most of which are native; however, there are no endemic species of fish in the Senegal Basin. Among the larger native benthopelagic taxa are: the 170 centimetre (cm) North African Catfish (Clarias gariepinus), the 149 cm Electric Catfish (Malapterurus electricus), and the 92 cm African Carp (Labeo coubie).

Some of the larger native demersal fishes of the Senegal Basin are: the 204 cm Aba (Gymnarchus niloticus). the 200 cm Nile Perch (Lates niloticus), the 183 cm Sampa (Heterobranchus longifilis), and the 150 cm Cornish Jack (Mormyrops anguilloides).

Pelagic native fishes in the Senegal River include the 65 cm True Big-scale Tetra (Brycinus macrolepidotus) and the 16 cm Ansorge Fangtooth Pellonuline (Odaxothrissa ansorgii)

Creative Commons Attribution 3.0 (CC BY 3.0)

© C. Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Diseases and Parasites

Annulotrema Infestation 4. Parasitic infestations (protozoa, worms, etc.)
  • Khalil, L.F. and J.P. Thurston 1973 Studies on the helminth parasites of freshwater fishes of Uganda including the descriptions of two new species of digeneans. Rev. Zool. Bot. afr. 87(2):209-248. (Ref. 52494)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Brycinus macrolepidotus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTTTACCTTGTATTTGGCGCCTGAGCTGGAATAGTTGGAACTGCTCTTAGTCTTCTAATCCGGGCAGAACTAAGTCAGCCCGGATCCCTTTTAGGGGATGACCAGATTTATAATGTTATCGTCACAGCACATGCATTCGTAATAATTTTTTTTATAGTTATACCAATCATAATTGGCGGCTTTGGGAACTGACTTGTGCCTTTAATAATTGGAGCCCCCGATATAGCATTCCCACGAATAAATAATATAAGCTTCTGACTTCTCCCCCCATCTTTCCTCCTCCTTTTAGCTTCTTCTGGGGTAGAAGCAGGAGCTGGAACAGGCTGAACTGTATACCCCCCTCTTGCCGGAAATCTTGCCCATGCAGGGGCCTCTGTCGACCTAACCATTTTCTCACTTCACCTCGCAGGGGTCTCTTCCATTCTTGGCGCAATCAATTTTATTACGACTATCGTAAACATGAAACCCCCCGCCATTTCACAATACCAAACCCCTCTGTTCGTTTGAGCCGTCTTAGTGACAGCCGTCCTTTTGCTTCTTTCCCTCCCCGTCCTAGCTGCAGGAATTACTATACTCTTAACGGACCGGAATTTAAACACCACTTTCTTTGACCCTGCCGGAGGGGGAGATCCAATCCTTTACCAACACTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Brycinus macrolepidotus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Azeroual, A., Getahun, A., Lalèyè, P., Moelants, T. & Twongo, T.

Reviewer/s
Snoeks, J., Tweddle, D., Getahun, A., Lalèyè, P., Paugy, D., Zaiss, R., Fishar, M.R.A & Brooks, E.

Contributor/s

Justification
This species has a wide distribution, with no known major widespread threats. It is therefore listed as Least Concern. It has also been assessed regionally as Least Concern for central, eastern, northern and western Africa. The species was only found in the Egyptian upper Nile within the northern Africa region and is now extinct in Egypt.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
More common in rivers than lakes (Bailey 1994)

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Heavy fishing pressure, including from commercial fisheries, may threaten populations of this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
None known. Population trends should be monitored.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
  • Trewavas, E. and F.R. Irvine 1947 Fresh-water fishes. p. 221-282. In F.R. Irvine (ed.) The fishes and fisheries of the Gold Coast. The Crown Agents for the Colonies, London. 352 p. (Ref. 11235)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!