Overview

Comprehensive Description

Brycinus macrolepidotus -

AMNH 240383, 6, 1 C&S;

  • Melanie L. J. Stiassny, Victor Mamonekene (2007): Micralestes (Characiformes, Alestidae) of the lower Congo River, with a description of a new species endemic to the lower Congo River rapids in the Democratic Republic of Congo. Zootaxa 1614, 17-29: 19-19, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:EFFDCA90-CD71-40DA-B0D1-5E2030D2D945
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

More common in rivers than lakes. Feeds on insects, crustaceans, fish, vegetation and debris (Ref. 28714).
  • Paugy, D. 1990 Characidae. p. 195-236. In C. Lévêque, D. Paugy and G.G. Teugels (eds.) Faune des poissons d'eaux douces et saumâtres de l'Afrique de l'Ouest. Tome I. Coll. Faune Tropicale n° XXVIII. Musée Royal de l'Afrique Centrale, Tervuren et O.R.S.T.O.M., Paris, 384 p. (Ref. 2880)   http://www.fishbase.org/references/FBRefSummary.php?id=2880&speccode=5229 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Brycinus macrolepidotus occurs throughout most of inter-tropical Africa, but is absent from the Gambia basin.

Central Africa: This species is known from throughout the Congo River basin.

Eastern Africa: It is found in Lake Albert, Albert and Murchison Niles, and the Aswa River (This species is known from upper Nile system)

Northern Africa: This species is now extinct in northern Africa, although it used to be caught from This species is known from upper Nile, Egypt.

Northeast Africa: It is present in the Ghazal and Jebel systems, White and Blue Niles, Nile to Lake Nasser (also known as Lake Nubia). Also found in Tekeze, Setit in Eritrea, and Baro and Omo Rivers in Ethiopia

Western Africa: Known from Senegal, Niger, Chad, Volta and basins from Sierra Leone to Cameroon.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Africa: Inter-tropical but absent in the Gambia basin. Senegal, Niger, Chad, Volta and basins from Sierra Leone to Cameroon; Sudan border, upper Nile, Albert Nile and Murchison Nile, Lake Albert, Victoria, Omo and Lake Turkana, Congo basin (Ref. 5331).
  • Paugy, D. 1990 Characidae. p. 195-236. In C. Lévêque, D. Paugy and G.G. Teugels (eds.) Faune des poissons d'eaux douces et saumâtres de l'Afrique de l'Ouest. Tome I. Coll. Faune Tropicale n° XXVIII. Musée Royal de l'Afrique Centrale, Tervuren et O.R.S.T.O.M., Paris, 384 p. (Ref. 2880)   http://www.fishbase.org/references/FBRefSummary.php?id=2880&speccode=5229 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Africa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Anal spines: 3; Analsoft rays: 10 - 16
  • Paugy, D. 1990 Characidae. p. 195-236. In C. Lévêque, D. Paugy and G.G. Teugels (eds.) Faune des poissons d'eaux douces et saumâtres de l'Afrique de l'Ouest. Tome I. Coll. Faune Tropicale n° XXVIII. Musée Royal de l'Afrique Centrale, Tervuren et O.R.S.T.O.M., Paris, 384 p. (Ref. 2880)   http://www.fishbase.org/references/FBRefSummary.php?id=2880&speccode=5229 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 530 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

53.0 cm SL (male/unsexed; (Ref. 2880)); max. published weight: 2,000 g (Ref. 3799)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

No fontanel even in young. Supra-orbital bone well developed. Upper jaw in adults longer than lower. Humeral and pre-caudal spots black. Greenish back, white belly. Sometimes with orange lateral stripe from opercle to caudal fin in adults only. Most fish have red-orange to pink fins. Only those from Cavally River have bright red fins. Juveniles with white spot on upper part of caudal peduncle. Gill rakers on first ceratobranch.
  • Paugy, D. 1990 Characidae. p. 195-236. In C. Lévêque, D. Paugy and G.G. Teugels (eds.) Faune des poissons d'eaux douces et saumâtres de l'Afrique de l'Ouest. Tome I. Coll. Faune Tropicale n° XXVIII. Musée Royal de l'Afrique Centrale, Tervuren et O.R.S.T.O.M., Paris, 384 p. (Ref. 2880)   http://www.fishbase.org/references/FBRefSummary.php?id=2880&speccode=5229 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

AMNH 240383, 6, 1 C&S;

License not applicable

Melanie L. J. Stiassny

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Brycinus macrolepidotus is potamodromous species, found more commonly in rivers than in lakes. It feeds on insects , crustaceans, small fish, vegetation and debris (Bailey 1994). It is a pelagic, potamodromous species (Riede 2004). The maximum published weight is 2000 g (Ita 1984). Spawning sites and season unknown.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

pelagic; potamodromous (Ref. 51243); freshwater; brackish
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 2 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 2 - 3

Graphical representation

Depth range (m): 2 - 3
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Potamodromous. Migrating within streams, migratory in rivers, e.g. Saliminus, Moxostoma, Labeo. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Fish Species Associates in the Senegal River

There are 141 species of fish recorded in the Senegal River, most of which are native; however, there are no endemic species of fish in the Senegal Basin. Among the larger native benthopelagic taxa are: the 170 centimetre (cm) North African Catfish (Clarias gariepinus), the 149 cm Electric Catfish (Malapterurus electricus), and the 92 cm African Carp (Labeo coubie).

Some of the larger native demersal fishes of the Senegal Basin are: the 204 cm Aba (Gymnarchus niloticus). the 200 cm Nile Perch (Lates niloticus), the 183 cm Sampa (Heterobranchus longifilis), and the 150 cm Cornish Jack (Mormyrops anguilloides).

Pelagic native fishes in the Senegal River include the 65 cm True Big-scale Tetra (Brycinus macrolepidotus) and the 16 cm Ansorge Fangtooth Pellonuline (Odaxothrissa ansorgii)

Creative Commons Attribution 3.0 (CC BY 3.0)

© C. Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Diseases and Parasites

Annulotrema Infestation 4. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Brycinus macrolepidotus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTTTACCTTGTATTTGGCGCCTGAGCTGGAATAGTTGGAACTGCTCTTAGTCTTCTAATCCGGGCAGAACTAAGTCAGCCCGGATCCCTTTTAGGGGATGACCAGATTTATAATGTTATCGTCACAGCACATGCATTCGTAATAATTTTTTTTATAGTTATACCAATCATAATTGGCGGCTTTGGGAACTGACTTGTGCCTTTAATAATTGGAGCCCCCGATATAGCATTCCCACGAATAAATAATATAAGCTTCTGACTTCTCCCCCCATCTTTCCTCCTCCTTTTAGCTTCTTCTGGGGTAGAAGCAGGAGCTGGAACAGGCTGAACTGTATACCCCCCTCTTGCCGGAAATCTTGCCCATGCAGGGGCCTCTGTCGACCTAACCATTTTCTCACTTCACCTCGCAGGGGTCTCTTCCATTCTTGGCGCAATCAATTTTATTACGACTATCGTAAACATGAAACCCCCCGCCATTTCACAATACCAAACCCCTCTGTTCGTTTGAGCCGTCTTAGTGACAGCCGTCCTTTTGCTTCTTTCCCTCCCCGTCCTAGCTGCAGGAATTACTATACTCTTAACGGACCGGAATTTAAACACCACTTTCTTTGACCCTGCCGGAGGGGGAGATCCAATCCTTTACCAACACTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Brycinus macrolepidotus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Azeroual, A., Getahun, A., Lalèyè, P., Moelants, T. & Twongo, T.

Reviewer/s
Snoeks, J., Tweddle, D., Getahun, A., Lalèyè, P., Paugy, D., Zaiss, R., Fishar, M.R.A & Brooks, E.

Contributor/s

Justification
This species has a wide distribution, with no known major widespread threats. It is therefore listed as Least Concern. It has also been assessed regionally as Least Concern for central, eastern, northern and western Africa. The species was only found in the Egyptian upper Nile within the northern Africa region and is now extinct in Egypt.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
More common in rivers than lakes (Bailey 1994)

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Heavy fishing pressure, including from commercial fisheries, may threaten populations of this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
None known. Population trends should be monitored.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!