Overview

Comprehensive Description

Raja stellulata Jordan & Gilbert, 1880

Description: The egg cases of Raja stellulata (Figure 11) are large, 91 to 92 mm in length, with MAW about 66-70 % of ECL. The egg case is covered with dense fibers on the dorsal surface, thinner on the ventral. The outer fibrous covering appears as an intricately woven sheath with a wool-like texture. Beneath these fibers the egg case is smooth, with very fine longitudinal striations. The LKW is narrow, <10% of ECL, and not extending onto horns. Attachment fibers are present along lateral keels. Anterior apron border broad and concave, anterior horns become flattened towards the tips and hook inwards. Posterior apron nearly straight, broad, transverse, and about 1-2 mm wider than anterior apron width. The posterior horns are about 5 to 6 mm longer than anteriors, curved, conical and tapering, becoming flattened, but without filamentous tips. The tips are hook-shaped at the ends. Color after preservation a uniform brown.

Remarks: The egg case of R. stellulata has not been previously described. The egg case figured by Cox (1963: figure 5) as this species is actually that of B. trachura . The egg case of R. rhina and R. stellulata are somewhat similar, but can be easily distinguished by the narrower lateral keels present on the latter. Also, the attachment fibers on R. stellulata extend the length of the lateral keels, while the fibers on R. rhina egg cases originate midway along lateral keel of egg case.

Material examined: CAS 224344, 73.2 cm TL, off Davenport, California ( 36.9235 N , - 122.2275 W ), 88 m, 16 April 2004 .

  • David A. Ebert, Chante D. Davis (2007): Descriptions of skate egg cases (Chondrichthyes: Rajiformes: Rajoidei) from the eastern North Pacific. Zootaxa 1393, 1-18: 13-14, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:0C16005C-21BC-4252-823E-C83515FCFF28
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Oviparous. Distinct pairing with embrace. Young may tend to follow large objects, such as their mother (Ref. 205). Eggs are oblong capsules with stiff pointed horns at the corners deposited in sandy or muddy flats (Ref. 205). Egg capsules are 7.1-7.8 cm long and 5.5-7.0 cm wide (Ref. 41300).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Northeast and eastern central Pacific: confirmed from off the coasts of northern California, from Eureka to Coronado Bank, northern Baja California, Mexico (Ebert 2003, Miller and Lea 1972). There are no confirmed records or voucher specimens of Raja stellulata from north of California.

Reported to range into the Gulf of Alaska, but these records may be Bathyraja parmifera and not Raja stellulata (D. Ebert pers. obs. 2007, Ebert 2003, Mecklenberg et al. 2002). Raja stellulata is also reported from British Colombia, Canada, but its presence there is unconfirmed (Benson et al. 2001).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North Pacific: Bering Sea to northern Baja California, Mexico.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 760 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

76.0 cm TL (male/unsexed; (Ref. 2850))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

A row of strong, sharp spines along the mid-dorsal line from a point behind the eyes by less than the interorbital width to the first dorsal fin and continued beyond it with a single spine between the two dorsal fins; large spines on the shoulder girdle; a row of small spines on the inner edge of the orbit; a cluster of moderate spines along the edge of the pectoral fin from its tip to the snout, large spines in males (Ref. 6885). Dorsal fins small and well back on tail; caudal fin very small; anal fin absent; pectorals broad, attached to snout and incorporated with body; pelvic fins large and deeply notched (Ref. 6885). A horizontal fleshy ridge from either side of ventral surface of tail, more prominent posteriorly (Ref. 6885). Grayish brown, numerous dark spots of various sizes scattered on body, a weakly marked eye spot frequently present at base of pectoral fins (Ref. 6885).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Raja stellulata
Catalog Number: USNM 26975
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan
Year Collected: 1880
Locality: Monterey, Cal., Monterey County, California, United States, North America, Pacific
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Occurs mostly in rocky habitats (Ebert 2003). These skates can be found in water depths of 18–732 m (Miller and Lea 1972), although it is more common inshore to 100 m depth (Ebert 2003). Females reach maturity at 68 cm total length (TL) and males at 67 cm TL (Ebert 2003). Maximum size is 76 cm TL and size at birth is 12–16 cm TL (Ebert 2003).

Raja stellulata feed on benthic shrimps, cephalopods, and bony fishes (Ebert 2003).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; marine; depth range 18 - 732 m (Ref. 2850)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 13 specimens in 1 taxon.
Water temperature and chemistry ranges based on 10 samples.

Environmental ranges
  Depth range (m): 48 - 217.5
  Temperature range (°C): 1.817 - 7.591
  Nitrate (umol/L): 4.440 - 30.088
  Salinity (PPS): 31.727 - 33.784
  Oxygen (ml/l): 2.778 - 7.154
  Phosphate (umol/l): 1.152 - 2.517
  Silicate (umol/l): 19.458 - 53.226

Graphical representation

Depth range (m): 48 - 217.5

Temperature range (°C): 1.817 - 7.591

Nitrate (umol/L): 4.440 - 30.088

Salinity (PPS): 31.727 - 33.784

Oxygen (ml/l): 2.778 - 7.154

Phosphate (umol/l): 1.152 - 2.517

Silicate (umol/l): 19.458 - 53.226
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 18 - 732m.
From 18 to 732 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, paired eggs are laid. Embryos feed solely on yolk (Ref. 50449). Distinct pairing with embrace. Young may tend to follow large objects, such as their mother (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Raja stellulata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTTTACTTAATCTTTGGTGCCTGAGCAGGCATGGTCGGAACTGGCCTAAGCCTTTTAATTCGAGCAGAACTAAGTCAACCCGGGACCCTCCTAGGTGATGATCAGATTTATAATGTCATTGTTACAGCCCATGCCTTTGTAATAATCTTTTTTATGGTCATACCAATTATAATCGGGGGGTTCGGCAATTGACTCGTCCCCTTAATAATCGGCTCCCCAGACATAGCCTTCCCCCGCATAAATAATATAAGTTTTTGACTTTTGCCCCCCTCTTTCCTCCTCCTCCTGGCCTCCGCTGGGGTTGAAGCTGGGGCCGGAACAGGTTGAACTGTTTACCCGCCTTTGGCAGGGAATCTAGCCCATGCAGGAGCCTCCGTAGACTTAACAATTTTCTCTCTTCACTTGGCAGGTGTTTCATCCATTCTAGCCTCCATTAACTTCATCACCACAATTATTAATATAAAACCACCAGCAATCTCTCAGTACCAGACACCCTTATTCGTATGGTCGATTCTTGTTACAACTGTCTTACTTCTTATAGCCCTCCCAGTTCTAGCAGCCGGCATCACCATACTACTCACAGATCGTAATCTTAATACAACCTTCTTTGACCCAGCTGGAGGGGGGGACCCCATCCTGTACCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Raja stellulata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
Robinson, H.J., Ebert, D.A. & Cailliet, G.M.

Reviewer/s
Valenti, S.V., Kulka, D.W. & Fowler, S.L. (Shark Red List Authority)

Contributor/s

Justification
A skate found mostly in rocky habitats at depths of 18–732 m, but more common inshore to 100 m depth. The species is confirmed from off the coasts of northern California, from Eureka to Coronado Bank, northern Baja California, Mexico. There are no confirmed records or voucher specimens of Raja stellulata from north of California. Total annual commercial landings data for grouped catch of ‘Skate, unspecified’ for California show that landings declined from 2000–2005. However, this catch primarily originates from trawl fisheries, of which this species is an insignificant component. Scientific survey samples have confirmed that the species is only occasionally captured by trawls, but it is one of the most common species caught in longline surveys on rocky, un-trawlable reefs. The species may be an occasional bycatch in recreational fisheries, but fishing pressure is not considered a significant threat to it at present. There are no data to suggest that the species’ population has declined and it is assessed as Least Concern, given that its habitat offers it protection from fisheries. Research on the species is ongoing and further data will become available in the future.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Nothing is known on its population structure or status. Skates are generally not identified to species level and are often misidentified, precluding the collection of accurate species-specific catch data. This species has not been the subject of any research until very recently.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Raja stellulata appears to occur mostly on rocky substrates that appear to preclude its capture by bottom trawler fishing vessels. Therefore, it is only occasionally taken as trawl bycatch (Ebert 2003). Although total annual commercial landings data for grouped catch of ‘Skate, unspecified’ for California show that landings declined from 2000–2005, of the species that form this catch this is probably the least likely skate to be taken. This species is only very occasionally seen in samples of National Marine Fisheries Service (NMFS) trawl surveys, whereas it is one of the most common species caught in NMFS longline surveys on rocky, un-trawlable reefs (D. Ebert pers. obs. 2007). Given the species’ shallow water occurrence it is likely only taken occasionally as a bycatch in recreational fisheries, but there are no data to confirm this (D. Ebert pers. obs. 2007). Therefore current fishing pressure is not considered a significant threat to this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Measures in place
California’s Marine Life Protection Act, effective from 21st September 2007, establishes a Central Coast Region, composed of 29 marine protected areas (MPAs) off the state. (See: http://www.dfg.ca.gov/mlpa/newsroom_083107.asp for further details). The 29 sites within the Central Coast MPA series represent approximately 204 square miles (roughly 18%) of state waters in the Central Coast Study Region. The implementation of these MPAs in currently ongoing.

Southern California waters are largely closed to trawl fishing at this time (D. Ebert pes. obs. 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!