Overview

Comprehensive Description

Biology

Affinities: P. bane and P. sauvagii.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Description

From Boulenger (1903):

Petrocephalus ansorgii, sp. n. (Boulenger, 1903, illustrated Plate XXYIII. fig. 2.)

A single specimen from Agberi.

Depth of body 3 times in total length, length of head 4 and 1/3. Head slightly longer than deep; snout rounded, 1/6 length of head; mouth situated below the eye, its width 1/5 length of head; teeth bicuspid, 10 in the upper jaw, 20 in the lower; nostrils close together, close to the eye, a little above the level of its lower border; eye large, twice as long as the snout, 1 and 1/3 interorbital width. Dorsal 33, originating above 9th ray of anal, its length 1½ in its distance from head. Anal 39, equally distant from base of ventral and from base of caudal. Pectoral pointed, ¾ length of head, twice as long as ventral and extending beyond base of latter. Caudal with pointed lobes. Caudal peduncle 3 times as long as deep, 2/3 length of head. 45 scales in the lateral line, 11/13 in a transverse series on the body, 14/12 in a transverse series between dorsal and anal, 8 round caudal peduncle. Silvery, brownish on the back and on the anterior rays of the dorsal.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Lavoué, Sébastien

Source: Africhthy

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

P. ansorgii is known from upper and Lower Niger, Benue and coastal rivers of Nigeria, extending to the Cross River.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Africa: Upper and Lower Niger, the Bénuoé, coastal rivers of Nigeria.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Holotype from Agberi, Lower Niger basin.

Distribution restricted to the Lower Niger basin.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Lavoué, Sébastien

Source: Africhthy

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

West-central Africa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 29 - 34; Analspines: 0; Analsoft rays: 35 - 39
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 141 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

14.1 cm SL (male/unsexed; (Ref. 2915))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

From Boulenger (1903): Total length 105 millim.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Lavoué, Sébastien

Source: Africhthy

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Body depth 2.9-3.5 x SL, caudal peduncle depth 18.8-21.6 x SL, base of anal fin 3.1-3.4 x SL. Eye diameter 3.0-3.5 x head length. Body silvery with 1st rays of dorsal darkened and dorsal spot separate from dorsal fin.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This is a demersal species.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Petrocephalus ansorgii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTATACCTAGTATTTGGTGCTTGAACCGGAATAGCTGGCACTGCACTGAGCCTTCTTATCCGAGCAGAACTAAACCAACCTGGGGCCTTGCTTGGCGACGACCAGATTTATAATGTCATCGTTACTGCACATGCCTTCGTAATAATTTTCTTCATGGTAATACCAATTATAATCGGAGGGTTCGGCAACTGACTAATCCCACTCATGCTAGGCGCCCCAGACATGGCGTTCCCCCGAATAAATAACATAAGCTTCTGACTACTACCCCCATCCTTCCTCCTTCTCCTTGCTTCTTCAGGAGTAGAGGCCGGGGTTGGAACCGGATGAACAGTCTATCCACCACTAGCCAGTAATTTAGCCCATGCCGGGGCCTCTGTTGATCTAGCCATCTTTTCCCTTCACTTGGCAGGAGTATCCTCTATTCTAGGCTCAATTAATTTCATCACCACAATTATTAACATAAAACCACCAGCAATTTCCCAGTACCAAACCCCACTATTTATCTGATCCCTGCTAGTAACCACAGTACTACTCCTACTCTCCCTGCCAGTTCTGGCTGCAGGCATTACTATGCTATTGACAGACCGAAATCTGAACACAACATTCTTCGACCCAGCCGGAGGAGGAGACCCAATTCTATATCAACACCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Petrocephalus ansorgii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Awaïss, A. & Lalèyè, P.

Reviewer/s
Snoeks, J., Tweddle, D., Getahun, A., Lalèyè, P., Paugy, D., Zaiss, R., Fishar, M.R.A & Brooks, E.

Contributor/s

Justification
This species has a wide distribution, with no known major widespread threats. It is therefore listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
No information available.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Habitat is undergoing a continuous decline due to oil exploration, and urban, commercial and deforestation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
None known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!