Overview

Comprehensive Description

Biology

Inhabits sandy runs and pools of creeks and small to medium rivers. Occurs usually in clear water. Often found near vegetation in the north part of range (Ref. 5723, 10294). Feeds on filamentous algae and detritus, in addition to the expected small invertebrates (Ref. 10294).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

endemic to a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Gulf Slope drainages from Suwannee River, Florida and Georgia, west to Nueces River in Texas; lowlands in Great Lakes, Hudson Bay (Red River), and Mississippi River basins from Michigan, Wisconsin, and Minnesota south to Gulf; common in south, uncommon and localized in north (Page and Burr 1991). Recently found in Winnipeg River, Manitoba (Stewart 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Gulf Slope drainages from Suwannee River, Florida and Georgia, west to Nueces River in Texas; lowlands in Great Lakes, Hudson Bay (Red River), and Mississippi River basins from Michigan, Wisconsin, and Minnesota south to Gulf; common in south, uncommon and localized in north (Page and Burr 1991). Recently found in Winnipeg River, Manitoba (Stewart 1988).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

U.S.A.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North America: lowlands in Great Lakes, Hudson Bay (Red River) and Mississippi River basins from Michigan, Wisconsin and Minnesota in the USA south to Gulf; Gulf Slope drainages from Suwannee River in Georgia and Florida in the USA to Nueces River in Texas, USA.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Length: 6 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Maximum size: 86 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

8.6 cm TL (male/unsexed; (Ref. 5723)); max. reported age: 3 years (Ref. 12193)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Paralectotype for Notropis nux
Catalog Number: USNM 125166
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): B. Evermann
Year Collected: 1891
Locality: Neches River, Palestine, Texas., Anderson County, Texas, United States, North America
  • Paralectotype: Evermann, B. W. & Kendall, W. C. 1894. Bulletin of the United States Fish Commission. 12 ( for 1892).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lectotype for Notropis nux
Catalog Number: USNM 45555
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): B. Evermann
Year Collected: 1891
Locality: Trinity River, Palestine, Texas., Anderson County, Texas, United States, North America
  • Lectotype: Evermann, B. W. & Kendall, W. C. 1894. Bulletin of the United States Fish Commission. 12 ( for 1892).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paralectotype; Paralectotype for Cyprinella texana Girard
Catalog Number: USNM 162721
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): J. Clark
Locality: Rio Salado, Texas., Texas, United States, North America
  • Paralectotype: Girard, C. F. 1857. Proceedings of the Academy of Natural Sciences of Philadelphia. 8: 198.; Paralectotype: Hubbs, C. 1954. Copeia. 1954 (1): 72-73.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lectotype; Lectotype for Cyprinella texana Girard
Catalog Number: USNM 128
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Dry Osteological Specimen; Photograph
Collector(s): J. Clark
Locality: Rio Salado, Texas., Texas, United States, North America
  • Lectotype: Girard, C. F. 1857. Proceedings of the Academy of Natural Sciences of Philadelphia. 8: 198.; Lectotype: Hubbs, C. 1954. Copeia. 1954 (1): 72-73.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Comments: Sandy runs and pools of creeks and small to medium rivers; usually in clear water (Page and Burr 1991). In south, mainly in open, sand-bottomed streams of widely varying sizes; in north, in streams sometimes with considerable aquatic vegetation (Lee et al. 1980). Also in sloughs and lakes.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Sandy runs and pools of creeks and small to medium rivers; usually in clear water (Page and Burr 1991). In south, mainly in open, sand-bottomed streams of widely varying sizes; in north, in streams sometimes with considerable aquatic vegetation (Lee et al. 1980). Also in sloughs and lakes.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

benthopelagic; freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 1.255 - 1.255
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Comments: Stomach samples from Wisconsin included plant debris and unidentifiable animal material (Becker 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Inhabits sandy runs and pools of creeks and small to medium rivers. Occurs usually in clear water. Often found near vegetation in the north part of range.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

An introduced population of rough shiner (Notropis baileyi) in the Chattahoochee River system may be responsible for an increase in the abundance of bluehead chub (Nocomis leptocephalus, a nest associate), and a decrease in the abundance of weed shiner (Notropis texanus), which may be affected by competition for food or habitat (Walser et al. 2000).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Spawns March through September or early October (peaks in early spring and late summer) in Mississippi (Heins and Davis 1984), February to September or early October in Alabama and Florida (Heins and Rabito 1988), late spring and early summer in north. Most individuals live 2+ years in south. (Lee et al. 1980, Becker 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Notropis texanus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 12 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATTTAGTATTTGGTGCCTGAGCCGGAATAGTGGGAACCGCTTTAAGCCTCCTTATTCGAGCCGAATTAAGTCAACCTGGTTCACTTCTAGGTGATGATCAAATCTATAATGTTATTGTTACTGCTCACGCCTTTGTAATAATTTTCTTTATAGTGATGCCAATTCTTATTGGTGGATTCGGAAACTGACTTGTACCTCTAATGATTGGAGCACCTGACATAGCATTTCCACGAATAAACAACATAAGCTTCTGACTTCTGCCCCCGTCGTTTCTACTGTTACTAGCCTCTTCTGGTGTTGAAGCCGGGGCTGGAACAGGATGAACTGTTTATCCCCCACTTGCAGGTAACCTCGCTCACGCAGGGGCATCAGTAGACCTTACAATCTTCTCCCTCCATCTAGCAGGTGTATCATCTATTTTAGGAGCAGTTAATTTTATCACCACAATTATTAACATGAAGCCCCCAGCAATCTCTCAATACCAAACGCCTCTCTTTGTATGAGCCGTACTTGTAACCGCCGTTCTCTTACTCCTGTCACTACCTGTTTTAGCGGCCGGGATTACTATACTTCTTACTGACCGTAACTTAAATACAACATTCTTTGACCCGGCAGGAGGAGGGGATCCTATTTTATATCAACATTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Notropis texanus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4 - Apparently Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
NatureServe

Reviewer/s
Smith, K. & Darwall, W.R.T.

Contributor/s

Justification
Listed as Least Concern in view of the large extent of occurrence, large number of subpopulations, large population size, and lack of major threats. Trend over the past ten years or three generations is uncertain but likely relatively stable, or the species may be declining but not fast enough to qualify for any of the threatened categories under Criterion A (reduction in population size).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is represented by a large number of subpopulations and locations.

Total adult population size is unknown but relatively large.

Has declined in the north (Herkert 1992).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Comments: Decline in north has been due to pollution and siltation (Herkert 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
Decline in north has been due to pollution and siltation (Herkert 1992).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Currently, this species is of relatively low conservation concern and does not require significant additional protection or major management, monitoring, or research action.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Weed Shiner

Weed Shiner (Notropis texanus) is a species of ray-finned fish in the genus Notropis.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: No subspecies are recognized, but differentiated populations occur in upper Apalachicola and Tombigbee drainages and in areas north of Illinois (Lee et al. 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!