Overview

Comprehensive Description

Biology

Inhabit sand and gravel runs and pools of creeks, and small to medium (sometimes large) rivers (Ref. 5723, 10294). Adults feed on surface insects and aquatic immatures (Ref. 10294).
  • Robins, C.R., R.M. Bailey, C.E. Bond, J.R. Brooker, E.A. Lachner, R.N. Lea and W.B. Scott 1991 Common and scientific names of fishes from the United States and Canada. Am. Fish. Soc. Spec. Pub. (20):183 p. (Ref. 3814)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (200,000-2,500,000 square km (about 80,000-1,000,000 square miles)) Range includes the Atlantic Slope of North America from the St. Lawrence River drainage, Quebec, to the Potomac River drainage, Virginia; Great Lakes (except Lake Superior), Hudson Bay (Red River), and Mississippi River basins from Ontario and New York to southeastern North Dakota and south to eastern Oklahoma and northern Alabama, with isolated populations in the Ozark region) (Page and Burr 2011).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Range includes the Atlantic Slope of North America from the St. Lawrence River drainage, Quebec, to the Potomac River drainage, Virginia; Great Lakes (except Lake Superior), Hudson Bay (Red River), and Mississippi River basins from Ontario and New York to southeastern North Dakota and south to eastern Oklahoma and northern Alabama, with isolated populations in the Ozark region) (Page and Burr 2011).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America: Atlantic Slope from St. Lawrence drainage in Canada to Potomac River drainage in Virginia, USA; Great Lakes (except Lake Superior), Hudson Bay (Red River) and Mississippi River basins from Ontario, Canada and New York to North Dakota and south to Alabama and eastern Oklahoma; in Ozarks, USA.
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

U.S.A. and Canada.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 11 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 120 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

12.0 cm TL (male/unsexed; (Ref. 5723)); max. reported age: 5 years (Ref. 12193)
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
  • Hugg, D.O. 1996 MAPFISH georeferenced mapping database. Freshwater and estuarine fishes of North America. Life Science Software. Dennis O. and Steven Hugg, 1278 Turkey Point Road, Edgewater, Maryland, USA. (Ref. 12193)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Comments: Habitat includes moderate to large streams and rivers of low to high turbidity, with bottom of sand, gravel, mud or rubble (Lee et al. 1980). Sometimes this species occurs in lakes and sloughs (Becker 1983). Most frequently it occurs in large creeks and small rivers with clear permanent flow; not typically in larger turbid rivers or intermittent creeks; usually it is in or near riffles or raceways over gravel in moderate to fast current (Mayden 1989). Spawning occurs in rock crevices, on logs having loose bark or crevices, or on underside of submerged logs or roots (Becker 1983, Scott and Crossman 1973), near riffles in swift current (Mayden 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Habitat includes moderate to large streams and rivers of low to high turbidity, with bottom of sand, gravel, mud or rubble (Lee et al. 1980). Sometimes this species occurs in lakes and sloughs (Becker 1983). Most frequently it occurs in large creeks and small rivers with clear permanent flow; not typically in larger turbid rivers or intermittent creeks; usually it is in or near riffles or raceways over gravel in moderate to fast current (Mayden 1989). Spawning occurs in rock crevices, on logs having loose bark or crevices, or on underside of submerged logs or roots (Becker 1983, Scott and Crossman 1973), near riffles in swift current (Mayden 1989).

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

benthopelagic; freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Arkansas River Benthopelagic Habitat

This taxon is one of a several benthopelagic species in the Arkansas River system. Benthopelagic river fish are found near the river bottom, feeding on benthos and zooplankton.The Arkansas River rises near Leadville, Colorado at an elevation of approximately 3010 meters about thirty kilometers north of Mount Elbert, Colorado's highest peak.

Tthe upper reaches of the Arkansas River manifest turbulent high gradient passage through rugged volcanic terrain; the flow continues to the Royal Gorge, where one of the world's highest suspension bridges towers 320 meters above the river surface; thereafter, the river course flows generally eastward through Kansas, thence southeastward through Oklahoma and Arkansas until its discharge to the Mississippi River. The river basin also includes parts of the states of New Mexico, Texas and Missouri.

Chief tributaries of the Arkansas River are Purgatoire River, Fountain Creek, Pawnee River, Salt Fork River, Illinois River,Verdigris River, Neosho River, Cimarron River and the Canadian River. The mean annual discharge at Little Rock, Arkansas is approximately 1118 cubic meters per second, a level remarkably undifferentiated from virgin flow, before the era of locks, impoundments and extraction.

Water quality at the headwaters near Leadville, Colorado is quite high, consisting of cold, rapidly flowing water of pH 6.3. Concentrations of calcium, sodium, magnesium and chloride are all less than ten milligrams per liter in this pristine headwaters area.

Crossing the Southern Plains below Great Bend, Kansas, the pH elevates to a level of 8.0, sodium concentrations rise to a range of 300 to 500 mg/l, with other ions rising by similar large percentages. After receiving the more pristine runoff from the Ozark Plateau, below Fort Smith, Arkansas, the pH level can be measured as low as 7.5, and sodium along with other ion concentrations are reduced by a factor of four. At the Mississippi Embayment, nitrate and phosphate levels are elevated due to row crop agricultural runoff of this region.

There are 141 species of fish present in the Arkansas basin, including two near endemic benthopelagic species: slough darter (Etheostoma gracile) and speckled darter (Etheostoma stigmae). The federally threatened and near-endemic Neosho madtom (Noturus placidus) occurs in the Neosho River, a tributary that rises in the Flint Hills. Also present in the Neosho River is the endangered Topeka shiner (Notropis topeka). The cardinal shiner (Luxilus cardinalis) is a near-endemic that is now restricted to populations in the Arkansas River and Red River, and disjunctive populations in the Neosho River.

In the upper Arkansas River mainstem a number of reptiles are found in the upper basin, including yellow mud turtle (Kinosternon flavescens), midland smooth softshell (Apalone mutica), western spiny softshell turtle (Apalone spinifera hartwegi) and northern water snake (Nerodia sipedon). In the downriver portions of the basin (Eastern Oklahoma and Arkansas) are found the false map turtle (Graptemys pseudogeographica) and the venomous cottonmouth (Agkistrodon piscivorus).

Creative Commons Attribution 3.0 (CC BY 3.0)

© C.Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits sand and gravel runs and pools of creeks, and small to medium (sometimes large) rivers.
  • Johnson, J.H. and D.S. Dropkin 1995 Diel feeding chronology of six fish species in the Juniata River, Pennsylvania. J. Freshwat. Ecol. 10(1):11-18. (Ref. 33056)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Eats mainly insects, both aquatic and terrestrial (Becker 1983); plants material and fishes also recorded in diet (Mayden 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: This species is represented by a very large number of occurrences (subpopulations).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Comments: Total adult population size is unknown but very large.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Most feeding activity occurs shortly before dusk and probably shortly after dawn (Mayden 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Spawns in late spring and summer. Eggs hatch in about 5 days. Both sexes sexually mature at age 1 but may not spawn until age 2 (Becker 1983). Most live only 2+ years; some reach 5 years. Produces sounds that may function in spawning activity and/or species recognition.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cyprinella spiloptera

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 20 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACACGCTGATTCTTTTCTACAAATCACAAAGACATTGGTACCCTTTACTTAGTATTTGGTGCCTGAGCTGGGATAGTGGGAACCGCTTTAAGCCTCCTCATTCGCGCTGAATTAAGTCAACCTGGCTCACTTCTAGGCGAT---GATCAGATCTACAATGTAATTGTTACTGCTCACGCCTTTGTAATAATTTTCTTTATAGTGATACCAATTCTTATCGGGGGGTTCGGGAACTGACTCGTACCTCTAATGATTGGGGCACCTGATATGGCATTTCCGCGGATGAATAACATAAGCTTCTGACTTCTACCCCCATCATTTCTCTTATTACTAGCTTCCTCTGGTGTTGAAGCTGGGGCTGGGACTGGATGAACTGTATATCCTCCACTTGCGGGTAATCTTGCTCACGCAGGAGCATCAGTAGATCTCACAATCTTCTCCCTGCACCTGGCGGGTGTGTCCTCAATTTTGGGAGCAGTTAATTTCATTACTACAATTATCAACATGAAGCCCCCAGCAATCTCCCAATATCAGACCCCTCTGTTCGTGTGAGCCGTACTTGTGACTGCCGTACTTCTTCTCCTCTCACTGCCCGTACTAGCTGCCGGGATTACTATACTTCTTACAGATCGTAATCTTAACACCACATTCTTTGACCCAGCAGGAGGGGGTGACCCTATTCTATATCAACACTTATTTTGATTCTTCGGCCACCCGGAGGTTTACATTCTTATTTTACCTGGGTTTGGAATTATTTCACACGTTGTAGCCTACTACGCGGGTAAAAAAGAACCATTTGGCTACATGGGAATAGTCTGAGCCATGATGGCCATTGGCCTTCTAGGATTTATTGTCTGAGCCCATCACATGTTTACTGTGGGAATGGATGTAGATACCCGCG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cyprinella spiloptera

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 20
Specimens with Barcodes: 43
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4 - Apparently Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
NatureServe

Reviewer/s
Smith, K. & Darwall, W.R.T.

Contributor/s

Justification
Listed as Least Concern in view of the large extent of occurrence, large number of subpopulations, large population size, apparently stable or slowly declining trend, and lack of major threats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Trend over the past 10 years or three generations is uncertain but likely relatively stable or slowly declining.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is represented by a very large number of occurrences (subpopulations).

Total adult population size is unknown but very large.

Trend over the past 10 years or three generations is uncertain but likely relatively stable or slowly declining.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: No major threats are known.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
No major threats are known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Currently, this species is of relatively low conservation concern and does not require significant additional protection or major management, monitoring, or research action.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Cyprinella spiloptera

The spotfin shiner (Cyprinella spiloptera) is a species of ray-finned fish in the Cyprinidae family. It is found only in the eastern United States and eastern Canada.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Removed from genus Notropis and placed in genus (formerly subgenus) Cyprinella by Mayden (1989); this change was adopted in the 1991 AFS checklist (Robins et al. 1991). Geographic variation was summarized by Schaefer and Cavender (1986), who rejected the two subspecies recognized by Gibbs (1957). Hybridization with the red shiner (C. lutrensis) in Illinois resulted in a rapid dilution of the spiloptera gene pool (Page and Smith 1970).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!