Overview

Comprehensive Description

Biology

Ranges from intertidal areas (where they may remain out of water under rocks or seaweeds, Ref. 31184) to deeper water over sand and mud bottoms (Ref. 4925). Adults make vertical migrations at night (Ref. 6885). Feed on crustaceans and fishes (Ref. 6885). Oviparous with eggs and larvae attached to nest wall (Ref. 36489). Nest is guarded by male (Ref. 36489). Important prey item for seals and sea lions (Ref. 2850). Adults breathe air when out of water (Ref. 31184). Possess photophores which are arranged on the underside of the head in a 'U' fashion.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

This species is endemic to the Eastern Pacific region, and is found from Smith Sound, British Colombia, Canada to Magdelana Bay, Baja California, Mexico.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific: Sitka, Alaska to Magdalena Bay, southern Baja California, Mexico. Records from areas south of Baja California and in the Gulf of California are in error. Two populations exist, one from Oregon northward and the other from San Francisco southward (Ref. 2850).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific [introduced in Australia].
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 2; Dorsal soft rays (total): 33 - 37; Analspines: 0; Analsoft rays: 30 - 35; Vertebrae: 42 - 46
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 380 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

38.0 cm TL (male/unsexed; (Ref. 2850))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Caudal fin rounded and narrow; pectorals broad (Ref. 6885). Olive brown to bronze or dark iridescent purple on dorsal surface, paler on sides with a golden yellow on ventral surface; white space under eye with a black crescent below; white on posterior edge of maxillary; young with a weak dark dorsal saddle (Ref. 6885). Branchiostegal rays: 6 (Ref. 36489).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Porichthys notatus
Catalog Number: USNM 520
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): A. Whipple
Locality: San Francisco, Cal., San Francisco County, California, United States, Pacific
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species is found over mud and sand bottoms to depths of over 300 m.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; marine; depth range 0 - 366 m (Ref. 2850)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 976 specimens in 1 taxon.
Water temperature and chemistry ranges based on 446 samples.

Environmental ranges
  Depth range (m): 1 - 265
  Temperature range (°C): 7.443 - 22.948
  Nitrate (umol/L): 0.440 - 27.924
  Salinity (PPS): 32.561 - 35.311
  Oxygen (ml/l): 2.801 - 5.506
  Phosphate (umol/l): 0.411 - 2.300
  Silicate (umol/l): 2.488 - 43.395

Graphical representation

Depth range (m): 1 - 265

Temperature range (°C): 7.443 - 22.948

Nitrate (umol/L): 0.440 - 27.924

Salinity (PPS): 32.561 - 35.311

Oxygen (ml/l): 2.801 - 5.506

Phosphate (umol/l): 0.411 - 2.300

Silicate (umol/l): 2.488 - 43.395
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 366m.
Recorded at 366 meters.

Habitat: demersal. Found from the intertidal area to deeper water over sand and mud bottom (Ref. 4925). Makes vertical migrations at night (Ref. 6885). Spawns during spring in shallow areas and as few as 19 or as much as 789 eggs have been found in a nest (Ref. 6885). Feeds on crustaceans and fishes (Ref. 4925). Important prey item for seals and sea lions. Possesses photophores which are arranged on the underside of the head in a 'U' fashion.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Found in inshore waters of the continental shelf (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Nests are cavities that are formed under rocks and eggs are deposited on the roof of the cavity. As few as 19 or as much as 789 eggs have been found attached in a nest. Eggs are guarded by the fasting male. Probably polygamous (Ref. 6885).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Porichthys notatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 17
Specimens with Barcodes: 23
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Porichthys notatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 17 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTGGCACCCTTTACTTAATCTTTGGTGCCTGAGCAGCCATAGTCGGCATAGCTCTCAGCCTCTTAATCCGAACAGAACTAACGCAGCCCGGGTCTCTACTCGGCAATGACCAAATCTATAACGTAATCGTCACTGCCCACGCATTCGTCATAATCTTCTTTATAGTAATGCCTATTATAATCGGGGGCTTTGGTAACTGGCTTATCCCCCTAATAATCGGGGCCCCAGATATAGCATTCCCTCGTATAAATAACATAAGCTTTTGACTTCTCCCCCCCTCTTTCCTTCTTCTTTTAGCCTCTTCCGTCGTTGAGACCGGAGTTGGAACCGGCTGAACTGTTTATCCCCCTCTAGCTGGCAACTTAGCCCACGCAGGGGCTTCTGTTGACCTCGCCATTTTTTCTCTCCATCTTGCAGGCATTTCCTCTATTTTAGGGGCTATTAACTTTATTACTACCATTATTAATATAAAAACCCCAGCTTCCACACAATACCAAACACCCTTATTTATCTGAGCTACTTTAGTTACCGCTGTCCTTCTTCTATTATCCCTACCTGTATTAGCAGCCGGCATTACTATGCTACTAACAGACCGTAACTTAAACACCACCTTTTTTGACCCCGCAGGTGGAGGAGACCCTATCCTTTACCAACACCTATTCTGATTCTTCGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Collette, B., Acero, A., Betancur, R., Cotto, A. & Rojas, P.

Reviewer/s
Carpenter, K., Polidoro, B. & Livingstone, S. (Global Marine Species Assessment Team)

Contributor/s

Justification
This deep-water species is widespread in the Eastern Pacific region. No major threats to this species are known, and there is no current indication of population decline. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
No population information is available for this species.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
No major threats are known for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
No conservation measures are known for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of potential interest
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Porichthys notatus

Porichthys notatus is a species of fish in the toadfish family. It is a midshipman known by the common name plainfin midshipman. It is native to the eastern Pacific Ocean, where its distribution extends along the coast from Sitka, Alaska, to Magdalena Bay in southern Baja California.[1]

Description[edit]

This fish reaches up to 38 centimeters in length. It is brownish to olive to iridescent purple dorsally, becoming lighter on the sides and yellowish on the belly. Below the eye is a whitish patch and black crescent. A young individual may have a dark saddle-mark. The fish has wide pectoral fins and a narrow but rounded tail fin.[1]

Basic biology[edit]

Habitat types for this marine fish include intertidal zones, where it seeks cover under rocks and in patches of seaweed. It can also be found on the seabed in deeper water,[1] sometimes over 300 meters.[1][2]

The conditions of the intertidal habitat type change regularly with the tide. A fish sheltering among the rocks can become stranded as the tide recedes, even becoming beached completely out of the water. The fish tolerates this well.[3] It can breathe air.[1] Physiologically, it is well adapted to hypoxia, as well as hypercapnia. Even its sperm are quite functional in low-oxygen conditions.[3]

Its diet includes crustaceans and fish.[1] It is nocturnal, feeding at night and resting during the day, when it buries itself in the sand.[4]

The fish is oviparous. The male claims a nest site, which is generally under a rock in the intertidal zone. Once the female spawns she leaves the eggs in the care of the male and departs.[3] One female can lay about 400 eggs, but the male may mate with a few females and end up with over 1000 eggs in his nest.[4] The eggs and larvae are adhered to the wall of the nest.[1] The male tends them by fanning them, keeping the nest clean, and hydrating them if they begin to desiccate at low tide. He protects the larvae post-hatching until they reach their juvenile stage and leave the nest, about 45 days after fertilization.[3] Very occasionally, an egg will yield twin larvae.[5]

These behaviors are not uniform for all males of the species. The male is dimorphic; the literature refers to Type I males and Type II males. The Type I male provides paternal care to the brood. He defends territory and courts females. The Type II male, on the other hand, does not tend a nest or court the females. He sneaks fertilizations. He is much smaller in size than the Type I, as well.[3]

Bioluminescence[edit]

This fish is bioluminescent. It has photophores in the skin of its head and much of its body. One fish has over 700 photophores, each about a millimeter wide. They contain luciferin. Norepinephrine activates them, producing a distinct fluorescent green glow.[6] The fish is only luminescent during courtship.[7] It may however, play a role in predator avoidance, as well. In the juvenile, photophores point ventrally, directing their illumination downwards. This helps to shadow the fish in a silhouette that might make it harder for predators to see.[8]

Not all individuals express this trait. There are two main populations of the species, a southern population found as far north as San Francisco, and a second population extending to the northern reaches of its range.[1] Fish of the southern population are bioluminescent, but most northern fish are not,[6] particularly those from the Puget Sound.[7] The nonluminescent fish lack luciferin in their photophores.[6] In experiments, nonluminescent fish can be made luminescent by dosing them orally or by injection with luciferin obtained from the luminescent ostracod crustacean Vargula hilgendorfii. This crustacean has a similar, but not identical, luciferin compound which can apparently function in the photophores of the fish, as well. It is thought that the fish obtains its luciferin in the wild by eating this type of crustacean, perhaps a relative such as Vargula tsujii, and that the nonluminescent northern population does not have any of these available to them.[6]

Vocalization[edit]

Both male and female of the species produce vocalizations. The female may produce a brief grunting sound, usually in agonistic encounters. The Type II male performs similar behaviors. The Type I male is much more vocal, both in conflict situations and in courtship. He utters long strings of grunts and growls while fighting, but his courtship call is more of a prolonged hum.[9] He may produce this sound for over an hour at a time, reaching frequencies near 100 Hz.[10] When a male makes the sound, gravid females respond by moving toward him.[11]

The fish produces the sound using the muscles of its modified swim bladder.[10] It receives the sound in its saccule, a sensory organ in the inner ear. During the breeding season, hormones induce the microscopic anatomy of the female's saccules to change in such a way that she can better sense the harmonics of the male's calls.[9]

People in some areas are very familiar with the sound of this fish. Where there are many breeding males, the sound of many simultaneous long, loud underwater courtship calls can be clearly heard on land. In parts of Washington[12] and in the San Francisco Bay Area there are noisemaking populations. The fish is notorious in Sausalito, California, where a community of people live on houseboats. The resident population of the fish becomes very obvious during the breeding season, when it spends the night vocalizing so loudly it keeps the houseboat residents awake.[13] Its calling is most intense between midnight and 6:00 am.[14] Despite its annoying behavior the fish inspired an affectionate local tribute in Sausalito, the Humming Toadfish Festival.[13]

The sound of the vocalization has been likened to a chorus of kazoos, B-29s flying in formation,[13] an amplifier, a didgeridoo, "a drone of bees or maybe even the chanting of monks,"[15] and "an orchestra full of mournful, rasping oboes."[16]

Ecology[edit]

This fish is an important prey for the Bald Eagle in some coastal areas, being the most common food provided to eaglets by their parents in one study on Vancouver Island. This is a concern, however, because this fish has been found to contain relatively high levels of contaminants, such as dioxin. It is also prey for the Northwestern Crow, the Glaucous-winged Gull, and the Great Blue Heron.[17] It is eaten by seals and sea lions.[1]

This fish is host to the parasitic copepods Lepeophtheirus remiopsis and Hamaticolax prolixus.[18]

Conservation[edit]

This is not a threatened species. It is widespread and apparently not in decline.[2]

References[edit]

  1. ^ a b c d e f g h i Froese, R. and D. Pauly, Eds. Porichthys notatus. FishBase. 2011.
  2. ^ a b Collette, B., et al. 2010. Porichthys notatus. In: IUCN 2012. IUCN Red List of Threatened Species. Version 2012.2. Downloaded on 05 June 2013.
  3. ^ a b c d e Craig, P. M., et al. (2013). Coping with aquatic hypoxia: How the plainfin midshipman (Porichthys notatus) tolerates the intertidal zone. Environ Biol Fish. In press.
  4. ^ a b Mensinger, A. F. and J. F. Case. (1991). Bioluminescence maintenance in juvenile Porichthys notatus. Biol Bull 181 181-88.
  5. ^ Stephens, R. R. (1973). Twinning in Porichthys notatus Girard. Transactions of the American Fisheries Society 102(4) 846.
  6. ^ a b c d Thompson, E. M., et al. (1988). Induction of bioluminescence capability in the marine fish, Porichthys notatus, by Vargula (crustacean) (14C)luciferin and unlabelled analogues. J. Exp. Biol. 137 39-51.
  7. ^ a b Tsuji, F. I., et al. (1972). Bioluminescence in the marine teleost, Porichthys notatus, and its induction in a non-luminous form by Cypridina (ostracod) luciferin. (Letter). Nature 237 515-16.
  8. ^ Harper, R. D. and J. F. Case. (1999). Disruptive counterillumination and its anti-predatory value in the plainfish midshipman Porichthys notatus. Marine Biology 134 529-40.
  9. ^ a b Sisneros JA (April 2007). "Saccular potentials of the vocal plainfin midshipman fish, Porichthys notatus". Journal of Comparative Physiology A 193 (4): 413–24. doi:10.1007/s00359-006-0195-5. PMC 2582148. PMID 17143623. 
  10. ^ a b Forbes JG, Morris HD, Wang K (April 2006). "Multimodal imaging of the sonic organ of Porichthys notatus, the singing midshipman fish". Magnetic Resonance Imaging 24 (3): 321–31. doi:10.1016/j.mri.2005.10.036. PMID 16563962. 
  11. ^ Zeddies DG, Fay RR, Alderks PW, Shaub KS, Sisneros JA (May 2010). "Sound source localization by the plainfin midshipman fish, Porichthys notatus". The Journal of the Acoustical Society of America 127 (5): 3104–13. doi:10.1121/1.3365261. PMID 21117759. 
  12. ^ Hum along with male plainfin midshipman fish. Morning Edition. National Public Radio. July 29, 2009.
  13. ^ a b c Bishop, K. Sausalito Journal; Voice of the turtle? No, toadfish love song. New York Times. June 26, 1989.
  14. ^ Sounds of the Plainfin Midshipman. Underwater Sound from the RTC Pier. Underwater Acoustics Research Group. San Francisco State University.
  15. ^ Lewis, T. 'Singing' fish hums to attract mates. LiveScience. February 19, 2013.
  16. ^ Perlman, D. Hormones fine-tune the humming toadfish: High levels of estrogen found in the most responsive females. San Francisco Chronicle. July 19, 2004.
  17. ^ Elliott, K. H., et al. (2003). Bald Eagles, Haliaeetus leucocephalus, feeding on spawning plainfin midshipman, Porichthys notatus, at Crescent Beach, British Columbia. The Canadian Field-Naturalist 117(4) 601-4.
  18. ^ Bailly, N. (2013). Porichthys notatus Girard, 1854. In: Froese, R. and D. Pauly, Eds. (2013). FishBase. World Register of Marine Species. Accessed on 5 June 2013.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!