Overview

Comprehensive Description

Biology

Common in bays and estuaries. Usually found amongst vegetation (Ref. 26938). Enters fresh water. Ovoviviparous (Ref. 205). The male carries the eggs in a brood pouch which is found under the tail (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The gulf pipefish, Syngnathus scovelli, is a slender, elongate fish that grows to 6 inches. It ranges from Florida and Louisiana through the Gulf of Mexico, Central and South America to Brazil (Targett 1984, Amos and Amos 1997). It typically inhabits shallow (< 6 m), densely vegetated, nearshore and estuarine waters. It is the only species among the 24 North American pipefishes that is known to enter freshwater areas (Amos and Amos 1997). S. scovelli exhibits sexual dimorphism, with females generally having deeper bodies and V-shaped silvery stripes along the trunk (Jones and Avise 1997). Body color is also different between the sexes, with females being an olive brown color, and males being much lighter. S. scovelli has no pelvic fins, but the elongate dorsal fin transverses 3 bony rings of dermal armor on the body and 5 on the tail. S scovelli is the most abundant pipefish in Florida and around the Gulf of Mexico (Brown 1972, Dawson 1982, Targett 1984).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Mouth of St. Johns River, Florida, south around coasts of Florida and Gulf of Mexico to Yucatan peninsula. Reproducing freshwater populations known from Santa Fe and lower St. Johns rivers, Florida, and lakes St. John and Bruin, Louisiana (Lee et al. 1980). Robins and Ray (1986) reported the range as extending to northern South America.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: northeastern Florida and northern Gulf of Mexico to the Caribbean coast of Central and South America; absent from West Indies.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Mouth of St. Johns River, Florida, south around coasts of Florida and Gulf of Mexico to Yucatan peninsula. Reproducing freshwater populations known from Santa Fe and lower St. Johns rivers, Florida, and lakes St. John and Bruin, Louisiana (Lee et al. 1980). Robins and Ray (1986) reported the range as extending to northern South America.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Syngnathus scovelli ranges from Brazil north through Central America and along the coastline of the Gulf of Mexico to Louisiana and Florida. The northern limit for this species was historically thought to be around the mouth of the St. John's River, in east central Florida (Dawson 1982, Targett 1984), however, an established breeding population was discovered on the northern Georgia coast by Targett in 1984.S. scovelli is typically found in seagrass beds and drift algae habitats; however, the Georgia population of this species is not associated with seagrasses or drift algae, but instead utilizes soft bottom sediments (Targett 1984). S. scovelli occurs lagoon-wide in the Indian River Lagoon, most commonly in seagrass habitats and among drift algae.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: Florida and Gulf of Mexico to Brazil; Central and South America; usually in nearshore marine habitats; some records from freshwater: Belize, Brazil, Guatemala, Honduras, Mexico, Panama, and Venezuela.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal soft rays (total): 2537
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 183 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

18.3 cm SL (male/unsexed; (Ref. 30499)); max. reported age: 3 years (Ref. 12193)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 15 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Watley (1969) reported freshwater specimens of S. scovelli ranging in size from 18 - 160 mm. Males with eggs in freshwater measured between 71 - 104 mm; but marine specimens ranged from 120 - 160 mm. Florida studies suggest that S. scovelli attains a total length (TL) of 91-149 mm (3.5 - 5.8 in.), with females generally larger than males (Motta et al. 1995). However, the perhaps atypical Georgia population of S. scovelli appears to be somewhat larger overall, with the largest male captured measuring 159 mm TL (6.3 in.), and the largest female measuring 149 mm TL (5.8 in.) (Targett 1984).S. scovelli has a lifespan of approximately 3 years (Watley 1969).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Moderately long snout (1.9-2.7 in head length) (Ref. 26938).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Paratype for Syngnathus scovelli
Catalog Number: USNM 69367
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): B. Evermann, Singley & Gurley
Year Collected: 1891
Locality: Corpus Christi, Texas., Texas, United States, Gulf of Mexico, Atlantic
  • Paratype: ; Evermann, B. W. & Kendall, W. C. 1895. Proceedings of the United States National Museum. 18 (1043): 113.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paralectotype; Syntype for Syngnathus scovelli
Catalog Number: USNM 218366
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): B. Evermann
Year Collected: 1891
Locality: Shamrock Point, Mustang Island, Corpus Christi Bay, Texas., Texas, United States, Corpus Christi Bay, Gulf of Mexico, Atlantic
  • Paralectotype: ; Evermann, B. W. & Kendall, W. C. 1895. Proceedings of the United States National Museum. 18 (1043): 113.; Syntype: ; Evermann, B. W. & Kendall, W. C. 1895. Proceedings of the United States National Museum. 18 (1043): 113.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lectotype; Syntype for Syngnathus scovelli
Catalog Number: USNM 47300
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): B. Evermann
Year Collected: 1891
Locality: Shamrock Point, Mustang Island, Corpus Christi Bay, Texas., Texas, United States, Corpus Christi Bay, Gulf of Mexico, Atlantic
  • Lectotype: ; Evermann, B. W. & Kendall, W. C. 1895. Proceedings of the United States National Museum. 18 (1043): 113.; Syntype: ; Evermann, B. W. & Kendall, W. C. 1895. Proceedings of the United States National Museum. 18 (1043): 113.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Euryhaline. Common in bays, estuaries, and seagrass in shallow and deep flats in marine situations, and among submergent vegetation in adjacent fresh waters. Males incubate eggs in brood pouch.

Systems
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

demersal; freshwater; brackish; marine; depth range ? - 6 m (Ref. 26938), usually ? - 6 m (Ref. 26938)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 22 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 0.5 - 6
  Temperature range (°C): 26.431 - 27.173
  Nitrate (umol/L): 0.529 - 0.742
  Salinity (PPS): 36.017 - 36.211
  Oxygen (ml/l): 4.595 - 4.656
  Phosphate (umol/l): 0.152 - 0.163
  Silicate (umol/l): 1.580 - 1.712

Graphical representation

Depth range (m): 0.5 - 6

Temperature range (°C): 26.431 - 27.173

Nitrate (umol/L): 0.529 - 0.742

Salinity (PPS): 36.017 - 36.211

Oxygen (ml/l): 4.595 - 4.656

Phosphate (umol/l): 0.152 - 0.163

Silicate (umol/l): 1.580 - 1.712
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Euryhaline. Common in bays, estuaries, and seagrass in shallow and deep flats in marine situations, and among submergent vegetation in adjacent fresh waters. Males incubate eggs in brood pouch.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Comments: Eats small crustaceans and occasionally gastropods.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

S. scovelli is heterotrophic, and like the sea horses, has an elongate, tubular snout, and a small terminal mouth (Bergert and Wainwright 1997). These somewhat unusual structural elements have lead investigators to suggest the pipette-like feeding structure in Syngnathid fishes is one specialization for suction feeding (Branch 1966, Osse an Muller 1980, Muller 1987, Bergert and Wainwright 1997).Motta et al. (1995) reported S. scovelli to have the narrowest diet of the 9 abundant fish species investigated in Tampa Bay, Florida. Larger individuals (>35 mm) of S. scovelli feed primarily on amphipods and cypris larvae (Motta et al. 1995) in seagrass beds, but it also feeds alternatively on copepods, isopods, gastropods, and juvenile shrimp (Kulczycki, Virnstein and Nelson 1981). This species has a low dietary overlap with other species, and a relatively low degree of herbivory (Motta et al. 1995). Seasonality also plays a role in the diet of S. scovelli. Livingston (1982) reported that S. scovelli is specialized to feed on amphipods during the winter and throughout the spring, but shifts its dietary focus to shrimp in the fall months. Algae of various types are often found among gut contents; however, ingestion of algae is believed to be incidental, and results from feeding on the small crustaceans living in algal communities (Motta et al 1995).Habitat: In the Indian River Lagoon, there was a positive correlation in capture rates of this species with the amount of drift biomass present, especially during the evening hours. (Kulczycki, Virnstein and Nelson 1981). However, Targett (1982) noted that S. scovelli does not have an absolute requirement for either seagrass or drift algal habitats, but can utilize soft bottomed habitats as well. S. scovelli does well in disturbed habitat areas (Watley 1969).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known prey organisms

  • Christian RR, Luczkovich JJ (1999) Organizing and understanding a winter’s seagrass foodweb network through effective trophic levels. Ecol Model 117:99–124
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Syngnathus scovelli (Pipefish and seahorses) is prey of:
sediment POC

Based on studies in:
USA: Florida (Estuarine)

This list may not be complete but is based on published studies.
  • Christian RR, Luczkovich JJ (1999) Organizing and understanding a winter’s seagrass foodweb network through effective trophic levels. Ecol Model 117:99–124
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

S. scovelli is the most abundant pipefish along the east coast of Florida, and the Gulf of Mexico (Brown 1972, Dawson 1982, Targett 1984).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Also Ref. 53335.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduces year-round in Florida, perhaps only in summer and fall in Texas. Sexually mature in 6 months, few survive beyond first year.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Members of the families Syngnathidae and Hippocampidae (pipefishes and sea horses) exhibit atypical reproductive behavior and parental care. Maternal and paternal brooding roles are reversed in these groups, with females producing large telolecithal eggs that are fertilized as they are deposited into the male brood pouch (Azzarello 1991). Jones and Avise (1997) suggested that the mating system in this species tends toward genetic polyandry, with a high likelihood that S. scovelli females are able to split a single batch of eggs among several males. Males brood from 1 - 3 clutches of eggs per season (Watley 1969). Sex ratios for this species have been observed from being in balance (1:1), to being slightly or greatly skewed in favor of females (Targett 1984). In Florida, the population from the St. John's River was reported to have a balanced sex ratio (McLane 1955); whereas the Georgia population has been observed with a sex ratio skewed as high as 1:15 in favor of females (Targett 1984). Other populations have been observed with sex ratios either in balance, or slightly skewed toward females depending upon time of year.In the Georgia population of S. scovelli, the brood pouch of the largest male was found to contain 296 embryos (Targett 1984). This is a significantly higher number of embryos than had been previously observed in other populations, where between 150-175 embryos was more common (Brown 1972, Joseph 1957). Targett (1984) postulated the higher number of embryos was in part due to the larger overall body size of males in this population compared with those of other populations.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Growth

S. scovelli is ovoviviparous, with role reversal of the usual brooding pattern. In the families Syngnathidae, as well as in the Hippocampidae, males incubate the large telolecithal eggs deposited by females. Eggs are fertilized upon deposition into the male brood pouch (Azzarello 1991). Embryos, which measure from 5-10 mm depending on maturation stage, are arranged lengthwise in the brood pouch, in parallel rows. Larval development lasts approximately 12 - 21 days depending on taxon. Newly hatched juveniles measure approximately 13 mm, and are capable of swimming, feeding and osmoregulating (Quast and Howe 1980, Azzarello 1991).The brood pouches of both Syngnathus scovelli, the gulf pipefish, and Hippocampus erectus, the lined seahorse, are both anatomically and histologically similar; however, they appear to have physiologically distinctive roles. In both the seahorse and the pipefish, the brood pouch functions to buffer newly deposited eggs by bathing them in a solution that is isosmotic to fish blood. The ions in these isosmotic fluids are derived from the blood of the parent rather than from the external environment (Quast and Howe 1980). During incubation, the sodium concentration in S. scovelli brood pouches is maintained at blood osmolality, while in Hippocampus brood pouches, the ion concentration is gradually shifted to be isosmotic to the external environment. Differences in habitat may account for this observation: Hippocampus species are principally marine, so the ability to adjust pouch fluid to match the generally stable marine environment may confer some selective advantage. In Syngnathus species, which are principally estuarine in nature, maintaining pouch fluids at blood osmolality, rather than subjecting developing embryos to widely varying changes in salinity, allows embryos to develop efficiently and perhaps decreases development time (Quast and Howe 1980). Quast and Howe (1980) suggested that the osmotic role of the Syngnathus brood pouch may enhance the reproductive success of this species in freshwater habitats. Azzarello (1991) concluded that the brood pouch is non-essential for nutritional survival, and that it serves and important osmoregulatory function only in embryos smaller than 4 mm., the time period preceding the development of gills, excretory chloride cells and kidneys.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Syngnathus scovelli

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATATCTAGTATTTGGTGCATGAGCCGGAATAGTGGGTACTGCACTTAGTCTCCTCATTCGAGCGGAGCTCAGTCAACCGGGAGCCCTCCTAGGCGATGACCAAATCTACAATGTAATCGTTACGGCCCATGCTTTCGTTATAATTTTCTTCATAGTTATACCTATCATAATTGGGGGTTTTGGTAATTGATTAGTACCTTTAATAATTGGAGCTCCAGACATAGCATTTCCTCGAATAAACAATATGAGCTTCTGATTACTGCCCCCTTCCTTTCTCCTCCTCCTTGCCTCTTCAGGAGTTGAAGCAGGTGCAGGTACAGGATGAACTGTTTACCCCCCTCTCTCAGGCAACTTAGCCCACCAAGGGGCTTCTGTGGATCTCACAATTTTCTCCTTACACCTCGCGGGTGTATCCTCAATTCTAGGGGCTATTAACTTCATCACCACTATCATTAATATGAAACCCCCTTCAATTTCTCAATACCAAACACCCTTATTTGTTTGGGCTGTTCTCATCACTGCCGTTCTGCTTCTTCTCTCCCTGCCTGTTCTAGCAGCCGGTATTACTATGCTGTTAACTGACCGAAATCTAAATACAACTTTCTTTGACCCCGCAGGAGGTGGGGACCCTATTCTCTACCAGCATCTCTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Syngnathus scovelli

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
NatureServe

Reviewer/s
Smith, K. & Darwall, W.R.T.

Contributor/s

Justification
Listed as Least Concern in view of the large extent of occurrence, large number of subpopulations, large population size, and lack of major threats. Trend over the past 10 years or three generations is uncertain but likely relatively stable, or the species may be declining but not fast enough to qualify for any of the threatened categories under Criterion A (reduction in population size).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is represented by a large number of subpopulations and locations.

Total adult population size is unknown but relatively large.

Trend over the past 10 years or three generations is uncertain but likely relatively stable or slowly declining.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Localized threats may exist, but on a range-wide scale no major threats are known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Localized threats may exist, but on a range-wide scale no major threats are known.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Currently, on a range-wide basis, this species is of relatively low conservation concern and does not require significant additional protection or major management, monitoring, or research action.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Gulf pipefish

Gulf pipefish, Syngnathus scovelli, is a pipefish species, inhabits the Western Atlantic from the northeastern Florida and northern Gulf of Mexico to the Caribbean coast of Central and South America, but absent from West Indies. Marine / freshwater / brackishwater tropical demersal fish, up to 18.3 cm length.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!