Overview

Comprehensive Description

Biology

Abundant in seagrass beds along coasts. Northern populations move offshore during colder months (Ref. 26938). Ovoviviparous (Ref. 205). The male carries the eggs in a brood pouch which is found under the tail (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Atlantic: disjunct distribution from Bermuda and Chesapeake Bay (USA), including the northern Gulf of Mexico, the Bahamas, and the western Caribbean Sea (Ref. 37039), to Panama.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Syngnathus floridae has a widespread distribution from Bermuda and Chesapeake Bay (USA), including the northern Gulf of Mexico, the Bahamas, and the western Caribbean Sea to Panama (Dawson 1982).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: disjunct distribution from Bermuda and Chesapeake Bay (USA) to northern Gulf of Mexico and Panama.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gulf of Mexico, North West Atlantic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal soft rays (total): 2635
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 250 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

25.0 cm TL (male/unsexed; (Ref. 7251))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Preorbital bone appears as broad plate in front of eye (Ref. 26938).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Paralectotype for Syngnathus floridae
Catalog Number: USNM 30773
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): S. Stearns
Locality: Pensacola, Escambia County, Florida, United States, North America
  • Paralectotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Syngnathus floridae
Catalog Number: USNM 133053
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): W. Schroeder
Year Collected: 1921
Locality: Virginia, Lower York River, Virginia, United States, Atlantic
  • Paratype: Herald, E. S. 1965. Proceedings of the California Academy of Sciences, Fourth Series. 32 (12): 368-36.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Syngnathus floridae
Catalog Number: USNM 218351
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): W. Schroeder
Year Collected: 1921
Locality: Virginia, Lower York River, Virginia, United States, Atlantic
  • Paratype: Herald, E. S. 1965. Proceedings of the California Academy of Sciences, Fourth Series. 32 (12): 368-36.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Holotype for Syngnathus floridae
Catalog Number: USNM 91321
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1921
Locality: Lower York River (Va.), Virginia, United States, Atlantic
Vessel: Fish Hawk
  • Holotype: Herald, E. S. 1965. Proceedings of the California Academy of Sciences, Fourth Series. 32 (12): 368-36.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Syngnathus floridae
Catalog Number: USNM 34989
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan
Year Collected: 1883
Locality: Key West, Monroe County, Florida, United States, Florida Keys, Atlantic
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Syngnathus floridae
Catalog Number: USNM 170920
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): W. Beebe & New York Zoological Society (NYZS)
Year Collected: 1931
Locality: Bermuda: Nonsuch Island, Nonsuch Island, Bermuda Islands, Bermuda, Atlantic
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Syngnathus floridae
Catalog Number: USNM 170917
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1930
Locality: Bermuda, Castle Harbor, Tuckerstown, Cove N. of Harbor, Bermuda, Atlantic
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Syngnathus floridae
Catalog Number: USNM 170919
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1930
Locality: Bermuda: Nonsuch Island, Nonsuch Island, Bermuda Islands, Bermuda, Atlantic
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Syngnathus floridae
Catalog Number: USNM 170918
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1930
Locality: Bermuda: Nonsuch Island, Nonsuch Island, Bermuda Islands, Bermuda, Atlantic
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Syngnathus floridae
Catalog Number: USNM 170916
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1929
Locality: Bermuda: Nonsuch Island, Nonsuch Island, Bermuda Islands, Bermuda, Atlantic
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Holotype for Syngnathus floridae
Catalog Number: USNM 170915
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1929
Locality: Bermuda: Nonsuch Island, Nonsuch Island, Bermuda Islands, Bermuda, Atlantic
  • Holotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Syngnathus floridae
Catalog Number: USNM 30826
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan & S. Stearns
Year Collected: 1882
Locality: Pensacola, Escambia County, Florida, United States, Gulf of Mexico, Atlantic
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cotype for Syngnathus floridae
Catalog Number: USNM 119832
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan & S. Stearns
Locality: Pensacola, Escambia County, Florida, United States, Gulf of Mexico, Atlantic
  • Cotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; marine; depth range ? - 22 m (Ref. 26938), usually ? - 4 m (Ref. 26938)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Syngnathus floridae can be found inhabiting coastal seagrass beds to a depth of 22 m. Males carry the eggs in a brood pouch which is found under the tail.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

benthic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 20 specimens in 1 taxon.
Water temperature and chemistry ranges based on 5 samples.

Environmental ranges
  Depth range (m): 0.5 - 1646
  Temperature range (°C): 4.196 - 27.173
  Nitrate (umol/L): 0.463 - 23.190
  Salinity (PPS): 34.977 - 36.017
  Oxygen (ml/l): 4.595 - 5.104
  Phosphate (umol/l): 0.103 - 1.589
  Silicate (umol/l): 1.124 - 28.123

Graphical representation

Depth range (m): 0.5 - 1646

Temperature range (°C): 4.196 - 27.173

Nitrate (umol/L): 0.463 - 23.190

Salinity (PPS): 34.977 - 36.017

Oxygen (ml/l): 4.595 - 5.104

Phosphate (umol/l): 0.103 - 1.589

Silicate (umol/l): 1.124 - 28.123
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Male carries the eggs in a brood pouch (Ref. 205, 53335).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Syngnathus floridae

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTATATCTAGTATTTGGTGCATGAGCCGGAATAGTGGGCACCGCACTTAGCCTTTTAATCCGGGCAGAACTTAGTCAACCGGGGGCCCTTCTTGGTGATGATCAAATTTATAATGTAATCGTTACAGCCCATGCTTTTGTTATGATTTTTTTCATAGTCATGCCTATCATGATTGGAGGATTTGGCAACTGATTAGTACCCCTAATGATTGGAGCCCCCGACATAGCATTCCCCCGAATGAACAACATGAGTTTCTGACTACTGCCCCCTTCCTTCTTACTCCTTCTTGCTTCCTCAGGAGTAGAGGCGGGTGCAGGCACAGGGTGAACTGTCTACCCCCCTCTCTCGGGTAATTTGGCCCATCAGGGAGCCTCTGTGGATCTAACAATCTTCTCCCTACACTTAGCAGGTGTATCCTCAATTCTAGGGGCTATTAACTTCATCACCACTATTATTAATATGAAACCCCCCTCAATCTCCCAATACCAAACACCCCTGTTTGTTTGAGCCGTACTAATCACTGCTGTGTTACTCCTCCTCTCCCTGCCTGTCTTAGCAGCCGGCATTACTATGCTTTTAACTGACCGAAATTTAAACACGACTTTCTTCGACCCTGCGGGAGGNGGTGATCCTATTCTCTACCAACATCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Syngnathus floridae

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Fritzsche, R., Collette, B., Nelson, J., Dooley, J., Carpenter, K., Bartnik, S., Robinson, E. & Morgan, S.K.

Reviewer/s
Collen, B., Richman, N., Beresford, A., Chenery, A. & Ram, M.

Contributor/s
De Silva, R., Milligan, H., Lutz, M., Batchelor, A., Jopling, B., Kemp, K., Lewis, S., Lintott, P., Sears, J., Wilson, P., Smith, J. & Livingston, F.

Justification
Syngnathus floridae is a very widespread species with no directed fishery and locally very abundant and therefore is of Least Concern. However, degradation of its seagrass habitat is cause for concern and should be monitored.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Syngnathus floridae is reported to be abundant in Chesapeake Bay (Ripley and Foran 2006). This species is also reported to be a common in Florida Bay (Thayer et al. 1999). A study conducted in Florida Bay in 1984-1985 recorded 33.1 individuals of this species per hectare, this study was replicated in 1994-1995 and 18.6 indiviudals were recorded per hectare (Thayer et al. 1999). This decrease in the numbers of Syngnathus floridae in Florida Bay was linked to the habitat degradation of seagrass meadows.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
There are no known major threats for Syngnathus floridae but seagrass meadows are under a number of threats relating to water quality such as sedimentation, coastal run-off, sewage outflows, as well as habitat disturbance from boat traffic and destructive fishing activity.

This species is not known for any commercial trade.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no known species-specific conservation measures in place for Syngnathus floridae, however its distribution may cover a number of marine protected areas.

Monitoring of this species habitat is needed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Dusky pipefish

Dusky pipefish (Syngnathus floridae) is a species of the pipefishes, widespread in the western Atlantic from the Bermuda, Chesapeake Bay (USA), northern part of the Gulf of Mexico, Bahama, and the western Caribbean Sea to Panama in south. Marine subtropical demersal fish, which lives at the depth up to 22 m, usually up to 4 m. The maximal length of the fish is 25.0 cm.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!