Overview

Comprehensive Description

Biology

A semi-pelagic and insular species commonly found in shallow turtle-grass beds (Ref. 5521). Ovoviviparous (Ref. 205). The male carries the eggs in a brood pouch which is found under the tail (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Atlantic: Scotian Shelf and Bermuda to the West Indies; extending to northern South America to Lesser Antilles.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: Canada (Ref. 5951) to North Carolina, USA and Bermuda to the West Indies; extending to northern South America (Ref. 7251). Lesser Antilles (Ref. 26938).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Maximum size: 75 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

7.5 cm TL (male/unsexed; (Ref. 7251))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Holotype for Bryx dunckeri
Catalog Number: USNM 170913
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1930
Locality: Bermuda: Nonsuch Island, Nonsuch Island, Bermuda Islands, Bermuda, Atlantic
  • Holotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

nektonic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

A semipelagic and insular species commonly found in shallow turtle-grass beds.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

benthopelagic; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 30 specimens in 1 taxon.
Water temperature and chemistry ranges based on 19 samples.

Environmental ranges
  Depth range (m): 0 - 3530
  Temperature range (°C): 21.085 - 27.717
  Nitrate (umol/L): 0.174 - 4.967
  Salinity (PPS): 34.447 - 36.754
  Oxygen (ml/l): 3.715 - 4.845
  Phosphate (umol/l): 0.081 - 0.372
  Silicate (umol/l): 0.868 - 4.423

Graphical representation

Depth range (m): 0 - 3530

Temperature range (°C): 21.085 - 27.717

Nitrate (umol/L): 0.174 - 4.967

Salinity (PPS): 34.447 - 36.754

Oxygen (ml/l): 3.715 - 4.845

Phosphate (umol/l): 0.081 - 0.372

Silicate (umol/l): 0.868 - 4.423
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Male carries the eggs in a brood pouch (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bryx dunckeri

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATATCTAGTATTCGGTGCATGAGCTGGTATAGTTGGTACTGCACTTAGCCTCCTAATCCGGACAGAGCTTAGTCAACCCGGGGCACTATTGGGCGACGATCAAATCTACAATGTAATTGTCACTGCCCATGCCTTCGTAATAATCTTCTTCATGGTAATACCAATTATAATCGGAGGCTTTGGCAATTGACTAATCCCTCTAATAATTGGAGCCCCAGACATAGCCTTCCCCCGAATGAACAACATAAGCTTCTGGTTACTCCCCCCATCATTTCTACTCCTTCTCGCCTCATCAGGAGTTGAAGCAGGTGCAGGTACAGGGTGAACTGTTTATCCCCCTCTAGCGGGTAACCTTGCTCACGCAGGAGCCTCAGTAGATTTAACAATTTTTTCCCTACATTTGGCAGGGGTATCTTCTATTCTAGGGGCTATCAATTTTATTACCACTATTATTAACATAAAACCCCCCTCAACTTCTCAATATCAGACGCCTTTATTTGTATGAGCAGTACTAATTACTGCTGTGTTACTTCTACTTTCCCTGCCCGTCCTAGCAGCTGGTATTACCATACTATTAACCGATCGTAATCTAAACACCACCTTCTTTGACCCAGCAGGAGGGGGAGACCCTATCTTGTACCAACATTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Bryx dunckeri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 22
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!