Overview

Comprehensive Description

Biology

Adults hover in loose groups above rocky bottoms (Ref. 27436). Pelagic juveniles are found in shallower water (Ref. 27436). Feed on small fishes and krill (Ref. 2850). Viviparous, with planktonic larvae (Ref. 36715). Validated age by radiometry is 44 yrs (Ref. 49687). Flesh is of good quality (Ref. 27436). Sold as fillets (Ref. 27436).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

British Columbia, Canadian Exclusive Economic Zone [Pacific part], Coastal Waters of Southeast Alaska and British Columbia, FAO fishing area 67, North East Pacific, North Pacific
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Pacific: south of the Shelikof Strait in the Gulf of Alaska to Cape Colnett, Baja California, Mexico.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern North Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13; Dorsal soft rays (total): 14 - 15; Analspines: 3; Analsoft rays: 7
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 760 mm FL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

76.0 cm FL (male/unsexed; (Ref. 3496)); max. published weight: 4,530 g (Ref. 4699); max. reported age: 84 years (Ref. 39247)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Head spines strong to moderate - nasal, preocular, supraocular, postocular, tympanic and parietal spines present, coronal and nuchal spines absent (Ref. 27437). Scales on lower jaw embedded; anal fin with a strong anterior slant (Ref. 27437). Caudal fin strongly indented (Ref. 6885). Bright yellow to orange mottled on a gray background; 3 orange stripes across head; fins orange; specimens less than 35.56 cm with dark markings on posterior part of spinous dorsal; gray along lateral line (Ref. 27437).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; marine; depth range 0 - 838 m (Ref. 55644), usually 90 - 270 m (Ref. 36715)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 590 specimens in 1 taxon.
Water temperature and chemistry ranges based on 323 samples.

Environmental ranges
  Depth range (m): 44.5 - 224.5
  Temperature range (°C): 6.508 - 8.705
  Nitrate (umol/L): 13.007 - 30.351
  Salinity (PPS): 32.561 - 33.926
  Oxygen (ml/l): 2.565 - 5.506
  Phosphate (umol/l): 1.398 - 2.545
  Silicate (umol/l): 21.984 - 46.902

Graphical representation

Depth range (m): 44.5 - 224.5

Temperature range (°C): 6.508 - 8.705

Nitrate (umol/L): 13.007 - 30.351

Salinity (PPS): 32.561 - 33.926

Oxygen (ml/l): 2.565 - 5.506

Phosphate (umol/l): 1.398 - 2.545

Silicate (umol/l): 21.984 - 46.902
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 425m.
Recorded at 425 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Feeds on euphausiids and fish (Ref. 2850).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Ovoviviparous (Ref. 6885).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 84 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sebastes pinniger

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 15 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATCCCCCTAATGATTGGAGCCCCAGATATAGCATTTCCCCGTATAAATAACATAAGCTTCTGACTTCTACCCCCCTCTTTCCTACTACTACTTGCCTCTTCTGGGGTAGAAGCGGGTGCCGGAACCGGATGAACAGTGTACCCGCCCCTGGCCGGTAATTTAGCCCACGCAGGAGCATCAGTAGACCTGACAATCTTTTCTCTCCACCTAGCAGGTATCTCCTCAATCCTTGGGGCAATCAATTTTATTACCACAATTATTAATATGAAGCCCCCGGCCATCTCTCAATACCAGACACCCTTATTTGTGTGAGCCGTCCTAATTACCGCTGTTCTTCTCCTTCTCTCCCTACCAGTTCTCGCTGCCGGCATCACAATGCTCCTTACCGACCGAAATCTTAATACCACCTTCTTTGACCCGGCAGGAGGGGGAGATCCCATCCTTTATCAGCACTTATTCTGGTTTTTTGGACACCCGGAAGTATATATTCTCATTCTGCCCGGCTTTGGTATGATTTCACACATCGTCGCCTATTACTCTGGCAAAAAAGAACCCTTTGGCTATATGGGCATGGTATGAGCAATAATGGCTATTGGCCTTCTAGGCTTTATTGTATGAGCCCATCACATATTCACAGTTGGCATGGACGTAGACACGCGTGCTTATTTCACGTCTGCCACAATAATCATCGCAATTCCCACCGGCGTTAAAGTATTTAGCTGACTTGCAACCCTTCATGGGGGCTCTATTAAATGAGAGACACCCCTTTTATGGGCCCTTGGCTTTATTTTCCTGTTTACAGTAGGGGGGCTCACAGGCATTGTTCTAGCCAATTCATCTCTAGATATCGTACTCCACGATACCTATTATGTAGTAGCCCACTTCCACTACGTACTATCTATGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Sebastes pinniger

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; gamefish: yes; aquarium: public aquariums
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Canary rockfish

The canary rockfish (Sebastes pinniger) is a rockfish of the Pacific coast, found from south of Shelikof Strait in the eastern Gulf of Alaska to Punta Colnett in northern Baja California.

Contents

Species description

As the name suggests, this rockfish is notable for a general orange-yellow appearance, consisting of a blotchy orange pattern over a whitish or light gray background. The head has three stripes angling downwards and back, the middle one generally running across the eye, and the other two on each side of the eye. The Lateral line is in a clear area. The fins are orange, with the pectoral, pelvic, and anal fins somewhat pointed and larger (thus the species epithet pinniger, meaning "I bear a large fin"). Some individuals have dark blotches on the body or dorsal fin. Maximum recorded length if 76 cm (29.6 in).

Ecology

Young canaries live in relatively shallow water, moving to deeper water as they mature. Adults are mostly found at depths of 80–200 meters (with two recorded at 838 meters), tending to collect in groups around pinnacles and similar high-relief rock formations, especially where the current is strong. Some off Oregon have been reported living over flat rock and mud-boulder bottoms. They may move considerable distances; one individual covered 700 km in four years after being tagged and released. Juveniles feed on small crustacea such as krill larvae (and eggs), copepods and amphipods, while adults eat krill and small fishes.

They have been an important commercial species since at least the early 1880s, with fisheries off San Francisco, California and Washington state. They are caught in trawling and hook and line operations, along with a variety of other fish such as yellowtail, lingcod, and other rockfishes. The numbers have been declining in recent years, and canaries are classified as overfished.

Conservation status

On October 29, 2007, the National Marine Fisheries Service (NMFS) received a petition from Sam Wright of Olympia, Washington to list a distinct population segment (DPS) of canary rockfish, and four other rockfishes, in Puget Sound, as an endangered or threatened species under the Endangered Species Act).[1] (ESA). NMFS found that this petition presented enough information to warrant conducting a status review of the species. Based on the status review NMFS proposed listing this species as threatened on April 23, 2009.[2] A final listing decision is due within a year.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!