Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Description

  Common names: moray (English), morena (Espanol)
 
Gymnothorax undulatus (Lacepède, 1803)

Undulated moray

Head pointed; tail ~ ½ TL; teeth pointed and well developed; 3 rows of teeth at front of top jaws, with 3 long fangs there; 1 row of teeth at sides of top jaws, sometimes with a few inner canines in small fish; dorsal and anal fins covered with skin, but clearly evident; dorsal fin high, origin before gill opening.



Usually pale yellowish, but also brown, grey or whitish; head heavily mottled with dark spots, top often greenish yellow; body with large dark blotches separated by diffuse yellowish lines, forming "chain-link" pattern, this pattern more pronounced in juveniles than adults, which are irregularly mottled.


Size: attains at least 150 cm.

Habitat: rocky bottoms.

Depth: 1-30 m.

Widespread in the Indo-Pacific from East Africa to the Americas; in the eastern Pacific it occurs from Costa Rica to Colombia, and the Revillagigedos Islands.
   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

A common species on reef flats among rocks, rubble, or debris and also occurs in lagoons and seaward reefs to depths of 26 m or more. Cavernicolous (Ref. 8593, 58302). Benthic (Ref. 58302). Nocturnal species that feeds on fishes, octopi, and probably crustaceans. Reported to be an aggressive species and prone to bite. Used in Chinese medicine (Ref. 12166).
  • Chen, H.-M., K.-T. Shao and C.T. Chen 1994 A review of the muraenid eels (Family Muraenidae) from Taiwan with descriptions of twelve new records. Zool. Stud. 33(1):44-64. (Ref. 6934)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, TEP non-endemic, Indo-Pacific only (Indian + Pacific Oceans), "Transpacific" (East + Central &/or West Pacific), All Pacific (West + Central + East)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: Northern Tropical (Mexican Province to Nicaragua + Revillagigedos), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-Pacific: East Africa, Port Alfred (South Africa), Seychelles, Madagascar and Mascarenes east to Panama, north to southern Japan, Ogasawara Islands, Hawaiian Islands and Gambier Islands, south to Western Australia at 28°54'S, New South Wales
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: Red Sea and East Africa, including Walters Shoal (Ref. 33390) to French Polynesia, north to southern Japan and the Hawaiian Islands, south to the southern Great Barrier Reef. Eastern Central Pacific: Costa Rica and Panama (Ref. 9324).
  • Halstead, B.W., P.S. Auerbach and D.R. Campbell 1990 A colour atlas of dangerous marine animals. Wolfe Medical Publications Ltd, W.S. Cowell Ltd, Ipswich, England. 192 p. (Ref. 4690)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth

Depth Range (m): 1 (S) - 30 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0; Vertebrae: 126 - 138
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length max (cm): 150.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 1500 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

150 cm TL (male/unsexed; (Ref. 1602))
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Distinctive pattern of light undulating lines and speckles on a dark green background. Snout often yellow (Ref. 30404).Description: Characterized by body depth at gill opening 12-21 in TL; origin of dorsal fin anterior to gill opening; anus at or slightly anterior to middle of body; long canine teeth anteriorly in jaws, some alternating with smaller teeth; front of upper jaw with three very long canines in median row; few inner canines on side of upper jaw in smaller specimens (Ref. 90102).
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

A common species on reef flats among rocks, rubble, or debris and also occurs on lagoons and seaward reefs to depths of 26 m or more. Reported to be an aggressive species prone to bite. It is an nocturnal species and feeds on fishes, octopuses, and probably crustaceans. Cavernicolous (Ref. 8593).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 30m.
Recorded at 30 meters.

Habitat: reef-associated. Leopard moray. - Misidentified in Southern African waters. Attains at least 1.5 metres. Very common from Port Alfred to southern Mozambique; Indo-Pacific. According to Dave Smith (pers. comm. Elaine Heemstra) the species which they identified as *Gymnothorax undulatus* is actually a new species which Dave Smith will be describing. G. undulatus only reaches Inhaca.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 9 - 110 m (Ref. 58302)
  • Mundy, B.C. 2005 Checklist of the fishes of the Hawaiian Archipelago. Bishop Museum Bulletins in Zoology. Bishop Mus. Bull. Zool. (6):1-704. (Ref. 58302)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 95 specimens in 3 taxa.
Water temperature and chemistry ranges based on 63 samples.

Environmental ranges
  Depth range (m): 0.15 - 80000
  Temperature range (°C): 22.018 - 29.336
  Nitrate (umol/L): 0.047 - 5.453
  Salinity (PPS): 33.507 - 36.032
  Oxygen (ml/l): 4.016 - 4.940
  Phosphate (umol/l): 0.085 - 0.708
  Silicate (umol/l): 0.888 - 6.667

Graphical representation

Depth range (m): 0.15 - 80000

Temperature range (°C): 22.018 - 29.336

Nitrate (umol/L): 0.047 - 5.453

Salinity (PPS): 33.507 - 36.032

Oxygen (ml/l): 4.016 - 4.940

Phosphate (umol/l): 0.085 - 0.708

Silicate (umol/l): 0.888 - 6.667
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Bottom, Bottom only

Habitat: Reef (rock &/or coral), Reef only, Rocks, Corals, Reef associated (reef + edges-water column & soft bottom)

FishBase Habitat: Reef Associated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits coral reefs (Ref. 58534). A common species on reef flats among rocks, rubble, or debris and also occurs in lagoons and seaward reefs to depths of 26 m or more. Cavernicolous (Ref. 8593, 58302). Benthic (Ref. 58302). Nocturnal species that feeds on fishes, octopi, and probably crustaceans. Reported to be an aggressive species and prone to bite (Ref. 11889).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Feeding

Feeding Group: Carnivore

Diet: mobile benthic crustacea (shrimps/crabs), octopus/squid/cuttlefish, bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gymnothorax undulatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTATACTTAGTCTTTGGTGCCTGAGCGGGTATGGTGGGCACCGCGCTAAGCCTTCTCATCCGGGCTGAACTCAGCCAGCCTGGTGCTCTACTAGGCGACGACCAAATTTATAATGTTATTGTTACAGCGCATGCGTTCGTAATAATTTTCTTTATAGTAATACCCGTAATAATTGGGGGGTTTGGAAACTGACTCATTCCCCTAATAATTGGGGCCCCTGACATGGCATTCCCCCGGATGAATAACATAAGCTTTTGGCTTCTCCCACCTTCCTTCCTCCTACTTTTGGCCTCCTCTGGGGTTGAAGCGGGAGCTGGTACCGGATGAACTGTTTACCCCCCTCTCGCAGGAAACCTAGCGCATGCAGGAGCCTCTGTGGACTTAACCATTTTTTCCCTCCACCTAGCAGGTGTTTCCTCAATTTTAGGAGCAATTAACTTTATTACAACCATCATCAATATGAAACCCCCAGCTATTACACAGTACCAAACACCCTTGTTTGTTTGAGCAGTTTTGGTCACAGCAGTGCTTCTCTTACTCTCTCTCCCAGTATTAGCAGCCGGCATCACAATACTACTAACCGACCGAAATCTCAACACCACCTTCTTTGACCCCGCGGGAGGAGGGGACCCCATCCTTTATCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Gymnothorax undulatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 58
Specimens with Barcodes: 69
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: medium; price reliability: very questionable: based on ex-vessel price for species in this family
  • Miyasaka, A. 1993 A database on scientific and common names of fishes exported from Hawaii. The information was derived from the above mentioned database. A printout of the names is also available from the State of Hawaii, Department of Land and Natural Resources, 1151 Punchbowl Street, Honolulu, Hawaii. (Ref. 5358)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Undulated moray

The undulated moray, Gymnothorax undulatus, is a moray eel of the family Muraenidae, found in the Indo-Pacific and east-centraln Pacific Ocean at depths down to 30 m. Their length is up to 1.5 m.

Undulated moray eating a
yellow tang, Zebrasoma flavescens

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!