Overview

Comprehensive Description

Biology

Found at the lower continental shelf and upper continental slope (Ref. 58437).
  • Last, P.R., M. Edmunds and G.K. Yearsley 2007 Squalus crassispinus sp. nov., a new spurdog of the 'megalops-cubensis' group' from the eastern Indian Ocean. p. 11-22. In P.R. Last, W.T. White and J.J. Pogonoski Descriptions of new dogfishes of the genus Squalus (Squaloidea:Squalidae). CSIRO Marine and Atmospheric Research Paper No. 014. 130 p. (Ref. 58437)   http://www.fishbase.org/references/FBRefSummary.php?id=58437&speccode=63433 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species was known as Squalus sp. D in Last and Stevens (1994). Occurs on the upper continental slope off northwestern Australia, from Port Hedland to North West Cape, at depths of 180 to 210 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Northwestern Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Indian Ocean: northwestern Australia; probably occurs more widely in the eastern Indian Ocean.
  • Last, P.R., M. Edmunds and G.K. Yearsley 2007 Squalus crassispinus sp. nov., a new spurdog of the 'megalops-cubensis' group' from the eastern Indian Ocean. p. 11-22. In P.R. Last, W.T. White and J.J. Pogonoski Descriptions of new dogfishes of the genus Squalus (Squaloidea:Squalidae). CSIRO Marine and Atmospheric Research Paper No. 014. 130 p. (Ref. 58437)   http://www.fishbase.org/references/FBRefSummary.php?id=58437&speccode=63433 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Max. size

47.6 cm TL (male/unsexed; (Ref. 58437)); 58 cm TL (female)
  • Last, P.R., M. Edmunds and G.K. Yearsley 2007 Squalus crassispinus sp. nov., a new spurdog of the 'megalops-cubensis' group' from the eastern Indian Ocean. p. 11-22. In P.R. Last, W.T. White and J.J. Pogonoski Descriptions of new dogfishes of the genus Squalus (Squaloidea:Squalidae). CSIRO Marine and Atmospheric Research Paper No. 014. 130 p. (Ref. 58437)   http://www.fishbase.org/references/FBRefSummary.php?id=58437&speccode=63433 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

This small species of the 'megalops-cubensis group' is distinguished by the following characters: head width at mouth 9.9-11.3% TL; mouth width 2.1-2.4 times the horizontal prenarial length; direct pre-second dorsal length 3.7-4.2 times the pectoral-fin anterior margin, 2.6-2.8 times the dorsal caudal margin; preoral length 2.7-3.0 times the horizontal prenarial length, 8.3-9.2% TL; anterior nasal flap strongly bifurcate; first dorsal fin upright to raked; the exposed bases of dorsal-fin spines are very broad, 1.2-1.5% TL; both dorsal fins have short inner margins, first dorsal-fin height 1.3-1.7 times its inner margin length, second dorsal-fin height 1.1-1.3 times its inner margin length; pectoral-fin anterior margin 1.9-2.2 times its inner margin length; preventral caudal margin 2.4-4.6 times inner margin of pelvic fin; caudal fin pale with poorly demarcated, whitish posterior margin, caudal bar absent; flank denticles unicuspid; monospondylous centra 39-42 (mainly 40-41), precaudal centra 82-86, total centra 107-111 (mainly 109-110) (Ref. 58437).
  • Last, P.R., M. Edmunds and G.K. Yearsley 2007 Squalus crassispinus sp. nov., a new spurdog of the 'megalops-cubensis' group' from the eastern Indian Ocean. p. 11-22. In P.R. Last, W.T. White and J.J. Pogonoski Descriptions of new dogfishes of the genus Squalus (Squaloidea:Squalidae). CSIRO Marine and Atmospheric Research Paper No. 014. 130 p. (Ref. 58437)   http://www.fishbase.org/references/FBRefSummary.php?id=58437&speccode=63433 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The biology of this dogfish is essentially unknown. The maximum total length is about 56 cm, with males maturing at around 44 cm.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

pelagic-oceanic; marine; depth range 187 - 262 m (Ref. 58437)
  • Last, P.R., M. Edmunds and G.K. Yearsley 2007 Squalus crassispinus sp. nov., a new spurdog of the 'megalops-cubensis' group' from the eastern Indian Ocean. p. 11-22. In P.R. Last, W.T. White and J.J. Pogonoski Descriptions of new dogfishes of the genus Squalus (Squaloidea:Squalidae). CSIRO Marine and Atmospheric Research Paper No. 014. 130 p. (Ref. 58437)   http://www.fishbase.org/references/FBRefSummary.php?id=58437&speccode=63433 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 215 - 215
  Temperature range (°C): 19.137 - 19.137
  Nitrate (umol/L): 6.464 - 6.464
  Salinity (PPS): 35.518 - 35.518
  Oxygen (ml/l): 4.064 - 4.064
  Phosphate (umol/l): 0.521 - 0.521
  Silicate (umol/l): 9.137 - 9.137
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Squalus crassispinus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATTTAATCTTTGGTGCATGAGCAGGAATAGTAGGTACCGCCCTTAGTTTGCTTATTCGAGCAGAATTAAGCCAACCTGGTTCTCTTCTGGGGGATGATCAAATCTATAATGTTATCGTAACTGCTCACGCTTTTGTAATAATCTTTTTTATAGTGATGCCTGTAATAATTGGTGGATTCGGAAACTGATTAGTACCTTTAATGATTGGTGCACCAGACATAGCTTTTCCACGAATAAATAATATAAGCTTTTGATTATTGCCTCCCTCCCTCCTATTACTTTTAGCCTCTGCTGGTGTTGAGGCGGGAGCCGGAACCGGCTGAACAGTCTACCCCCCTCTCGCAGGTAATATAGCTCATGCTGGAGCATCCGTAGACCTAGCCATCTTCTCACTCCATTTGGCTGGTATTTCCTCAATTCTAGCCTCTATTAATTTTATTACAACTATTATTAACATAAAACCACCTGCTATTTCTCAGTATCAAACACCACTCTTTGTTTGATCCATTCTTGTAACCACAGTCCTTCTTCTTCTTTCTCTTCCTGTTCTCGCAGCCGCAATTACGATGCTATTAACTGACCGTAATTTAAACACAACATTTTTTGATCCTGCTGGAGGGGGGGACCCAATTCTTTACCAACATTTANNN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Squalus crassispinus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2003

Assessor/s
Cavanagh, R.D. & Lisney, T.J. (SSG Australia & Oceania Regional Workshop, March 2003)

Reviewer/s
Shark Specialist Group Australia & Oceania Regional Group (Shark Red List Authority)

Contributor/s

Justification
Very little is known of the biology of this dogfish, which occurs on the upper continental slope off northwestern Australia with a known depth range of 180 to 210 m. At depths below 200 m this area is fished by the North West Slope Trawl and Western Deepwater Trawl fisheries. Based on its known depth range, Squalus crassispinus is unlikely to be a significant component of the bycatch of these deepwater fisheries, although information is sparse and it is highly likely that the distribution and range of this species is wider than current knowledge suggests. In addition, fishing effort is small with only a few boats operating in these fisheries, and it is unlikely the impact is cause for concern for this species at the present time. The current known range of this species is an area less than 10,000 km², thus may qualify for Vulnerable under B1, but the lack of data on the species’ biology (though it is likely to have the limiting life history characteristics similar to other deepwater shark species), details on its extent of occurrence, population size, or any indicator of population trend warrants a Data Deficient assessment at this time.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There is currently no information on population or subpopulation size.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
This species is known from a limited depth range of 180 to 210 m and on this basis is unlikely to be a significant component of the bycatch of the North West Slope Trawl and Western Deepwater Trawl fisheries since they operate at depths below 200 m. However, although it is likely that the distribution and range of this species is wider than is currently known, and it may occur well within the depth range of these fisheries, fishing effort is small with only a few boats in operation, and it is unlikely the impact is cause for concern for this species at the present time.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Data deficient (DD)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Currently there are no conservation measures in place for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Fatspine spurdog

The fatspine spurdog, Squalus crassispinus, is a dogfish of the family Squalidae, found on the continental shelf off the northern coast of Western Australia, at depths of 180 to 200 metres (590 to 660 ft). The length of the longest male specimen measured is 56 centimetres (22 in).

The fatspine spurdog is a rare, small and slender dogfish with a broad head and short snout. There is a broad, small medial barbel on the anterior nasal flaps. The pectoral fin has a shallowly concave posterior margin. The first dorsal fin is moderately high, and both dorsal fin spines are very stout.

Coloration is light grey above, paler below, with no white spots. The pale dorsal fins have dusky tips.

Its reproduction is ovoviviparous.

See also

References

  1. ^ R. D. Cavanagh & T. J. Lisney (2003). "Squalus crassispinus". IUCN Red List of Threatened Species. Version 2009.2. International Union for Conservation of Nature. Retrieved February 2, 2010. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!