Overview

Comprehensive Description

Biology

A generally uncommon species that inhabits lagoon and seaward reefs (Ref. 9710). Prefers rocky reefs and seems to avoid stony corals. Coastal, sometimes in surge zones where in narrow crevices, or along rock-walls in small caves (Ref. 48635). Found under ledges during the day (Ref. 9710). Feeds exclusively on small crabs and shrimps. Capable of inflicting a painful sting. Minimum depth reported taken from Ref. 30874.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-Pacific: Red Sea to Sodwana Bay, South Africa and to the Society Islands, north to the Ryukyu Islands, south to New Caledonia. Records from the Mascarene Islands lack verification and are probably based on Pterois antennata (Ref. 33390).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Djibouti, Kenya, Mozambique, Red Sea, Seychelles, Somalia, South Africa (country), Tanzania
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red Sea, Indo-West Pacific: East and South Africa east to Marshall, northern Line and Marquesas Islands, south to Western Australia, Queensland (Australia), New Caledonia and Tonga.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 12 - 13; Dorsal soft rays (total): 10 - 12; Analspines: 3; Analsoft rays: 5 - 6
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 240 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

24.0 cm TL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Reddish to brownish and with 5-6 broad dark bars on body separated by pale lines; horizontal dark area on caudal peduncle (Ref. 4313). Only species of Pterois that lacks markings between its vertical fin rays and has a pair of horizontal white stripes at base of its tail (Ref. 37816).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Capable of inflicting a painful sting. Inhabits lagoon and seaward reefs from the reef flat to a depth of at least 15 m. Feeds exclusively on small crabs and shrimps.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 1 - 30 m (Ref. 30573)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 60 specimens in 1 taxon.
Water temperature and chemistry ranges based on 52 samples.

Environmental ranges
  Depth range (m): 0.4575 - 75
  Temperature range (°C): 24.633 - 29.205
  Nitrate (umol/L): 0.016 - 0.862
  Salinity (PPS): 32.200 - 40.307
  Oxygen (ml/l): 4.314 - 4.851
  Phosphate (umol/l): 0.085 - 0.339
  Silicate (umol/l): 0.897 - 4.892

Graphical representation

Depth range (m): 0.4575 - 75

Temperature range (°C): 24.633 - 29.205

Nitrate (umol/L): 0.016 - 0.862

Salinity (PPS): 32.200 - 40.307

Oxygen (ml/l): 4.314 - 4.851

Phosphate (umol/l): 0.085 - 0.339

Silicate (umol/l): 0.897 - 4.892
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 1 - 30m.
From 1 to 30 meters.

Habitat: reef-associated. A generally uncommon species that inhabits lagoon and seaward reefs (Ref. 9710). Found under ledges during the day (Ref. 9710). Feeds exclusively on small crabs and shrimps. Capable of inflicting a painful sting.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Found in inshore waters (Ref. 75154). Lurks beneath ledges and crevices in luxuriant coral beds (Ref. 275).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pterois radiata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTGTATCTAGTATTTGGTGCCTGAGCCGGTATAGTAGGCACAGCCTTGAGCCTGCTTATTCGAGCAGAACTTAGTCAACCAGGCGCCCTATTAGGGGACGACCAAATCTATAACGTAATTGTTACAGCCCATGCGTTCGTAATAATTTTCTTTATAGTAATACCAATCATGATTGGAGGTTTTGGAAACTGACTTATCCCATTAATGATTGGGGCACCAGACATAGCATTTCCTCGTATGAATAACATAAGCTTTTGACTTCTTCCACCCTCTTTCCTGCTTCTTCTGGCCTCTTCCGGGGTTGAAGCAGGGGCTGGGACAGGTTGAACAGTCTACCCGCCACTGGCGGGCAATCTCGCCCATGCAGGAGCATCTGTAGACCTGACAATTTTTTCCTTGCACTTGGCAGGTATTTCATCAATTCTCGGGGCCATCAACTTTATTACAACAATTATTAACATGAAACCCCCAGCGATTTCTCAGTACCAAACTCCTTTATTTGTATGGGCTGTTTTAATTACAGCAGTTCTTCTGCTTCTTTCACTACCAGTCCTTGCCGCTGGCATTACGATGCTACTCACTGATCGAAACCTTAACACCACCTTCTTTGACCCGGCGGGAGGAGGGGACCCGATTCTCTACCAACACCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pterois radiata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: subsistence fisheries; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Pterois radiata

Pterois radiata, also known as the Clearfin Lionfish, Tailbar Lionfish, Radiata Lionfish or Radial Firefish, is a carnivorous, ray-finned fish with venomous spines that lives in the Indian and western Pacific oceans.

It is the only lionfish species which has spines without any markings. It can also be recognized by the pair of horizontal white stripes on its tail.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!