Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

A generally uncommon species that inhabits lagoon and seaward reefs (Ref. 9710). Prefers rocky reefs and seems to avoid stony corals. Coastal, sometimes in surge zones where in narrow crevices, or along rock-walls in small caves (Ref. 48635). Found under ledges during the day (Ref. 9710). Feeds exclusively on small crabs and shrimps. Capable of inflicting a painful sting. Minimum depth reported taken from Ref. 30874.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-Pacific: Red Sea to Sodwana Bay, South Africa and to the Society Islands, north to the Ryukyu Islands, south to New Caledonia. Records from the Mascarene Islands lack verification and are probably based on Pterois antennata (Ref. 33390).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-West Pacific: East and South Africa east to Marshall, northern Line and Marquesas Islands, south to Western Australia, Queensland (Australia), New Caledonia and Tonga.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 12 - 13; Dorsal soft rays (total): 10 - 12; Analspines: 3; Analsoft rays: 5 - 6
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 240 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

24.0 cm TL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Capable of inflicting a painful sting. Inhabits lagoon and seaward reefs from the reef flat to a depth of at least 15 m. Feeds exclusively on small crabs and shrimps.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reddish to brownish and with 5-6 broad dark bars on body separated by pale lines; horizontal dark area on caudal peduncle (Ref. 4313). Only species of Pterois that lacks markings between its vertical fin rays and has a pair of horizontal white stripes at base of its tail (Ref. 37816).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 1 - 30 m (Ref. 30573)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 60 specimens in 1 taxon.
Water temperature and chemistry ranges based on 52 samples.

Environmental ranges
  Depth range (m): 0.4575 - 75
  Temperature range (°C): 24.633 - 29.205
  Nitrate (umol/L): 0.016 - 0.862
  Salinity (PPS): 32.200 - 40.307
  Oxygen (ml/l): 4.314 - 4.851
  Phosphate (umol/l): 0.085 - 0.339
  Silicate (umol/l): 0.897 - 4.892

Graphical representation

Depth range (m): 0.4575 - 75

Temperature range (°C): 24.633 - 29.205

Nitrate (umol/L): 0.016 - 0.862

Salinity (PPS): 32.200 - 40.307

Oxygen (ml/l): 4.314 - 4.851

Phosphate (umol/l): 0.085 - 0.339

Silicate (umol/l): 0.897 - 4.892
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 30m.
From 1 to 30 meters.

Habitat: reef-associated. A generally uncommon species that inhabits lagoon and seaward reefs (Ref. 9710). Found under ledges during the day (Ref. 9710). Feeds exclusively on small crabs and shrimps. Capable of inflicting a painful sting.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Found in inshore waters (Ref. 75154). Lurks beneath ledges and crevices in luxuriant coral beds (Ref. 275).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pterois radiata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTGTATCTAGTATTTGGTGCCTGAGCCGGTATAGTAGGCACAGCCTTGAGCCTGCTTATTCGAGCAGAACTTAGTCAACCAGGCGCCCTATTAGGGGACGACCAAATCTATAACGTAATTGTTACAGCCCATGCGTTCGTAATAATTTTCTTTATAGTAATACCAATCATGATTGGAGGTTTTGGAAACTGACTTATCCCATTAATGATTGGGGCACCAGACATAGCATTTCCTCGTATGAATAACATAAGCTTTTGACTTCTTCCACCCTCTTTCCTGCTTCTTCTGGCCTCTTCCGGGGTTGAAGCAGGGGCTGGGACAGGTTGAACAGTCTACCCGCCACTGGCGGGCAATCTCGCCCATGCAGGAGCATCTGTAGACCTGACAATTTTTTCCTTGCACTTGGCAGGTATTTCATCAATTCTCGGGGCCATCAACTTTATTACAACAATTATTAACATGAAACCCCCAGCGATTTCTCAGTACCAAACTCCTTTATTTGTATGGGCTGTTTTAATTACAGCAGTTCTTCTGCTTCTTTCACTACCAGTCCTTGCCGCTGGCATTACGATGCTACTCACTGATCGAAACCTTAACACCACCTTCTTTGACCCGGCGGGAGGAGGGGACCCGATTCTCTACCAACACCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pterois radiata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: subsistence fisheries; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pterois radiata

Pterois radiata, also known as the clearfin lionfish, tailbar lionfish, radiata lionfish or radial firefish, is a carnivorous, ray-finned fish with venomous spines that lives in the Indian and western Pacific Oceans. This is the only lionfish species which has spines without any markings. It can also be recognized by the pair of horizontal white stripes on its caudal peduncle.

Description[edit]

Pterois radiata grows to a length of about 24 cm (9 in) though a more usual size is 20 cm (8 in). The dorsal fin has twelve or thirteen long, venomous spines and ten to twelve soft rays. The anal fin has three spines and five to six soft rays. The large pectoral fins flare out to the side and are clear and unbanded. The other fins are also colourless. The head and body colour is reddish-brown with about six vertical dark bands of different colour on the body separated by thin white lines. There are two white horizontal lines on the caudal peduncle which distinguishes this fish from other similar lionfishes.[1][2]

Distribution and habitat[edit]

Pterois radiata is native to the western Indo-Pacific region. Its range extends from South Africa and the Red Sea to Indonesia, the Society Islands, the Ryukyu Islands, northern Australia and New Caledonia. It is found on both inshore and offshore rocky reefs at depths down to about 25 m (82 ft). Juvenile fish are sometimes found in tide pools.[2]

Biology[edit]

Pterois radiata is mainly nocturnal. It spends the day hiding in rock crevices, in small caves or under overhangs. It emerges at night to feed on invertebrates such as crabs and shrimps.[1]

References[edit]

  1. ^ a b "Pterois radiata Cuvier, 1829: Radial firefish". FishBase. Retrieved 2014-01-01. 
  2. ^ a b King, Dennis; Fraser, Valda (2002). More Reef Fishes & Nudibranchs: East and South Coast of Southern Africa. Struik. p. 28. ISBN 9781868726868. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!