Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Description

  Common names: soldierfish (English), candil (Espanol), soldado (Espanol)
 
Myripristis berndti Jordan & Evermann, 1903


Bigscale soldierfish,     Blotch-eye soldierfish



Body ovate, deep; mouth moderately large, oblique; lower jaw of adults prominently projecting when mouth closed; snout blunt, forehead convex; eye very large; no spine at corner of preopercle, which has a concave edge; opercle with one short spine, inner ridge of opercle and other head bones serrated; 35-42 gill rakers; dorsal fin with XI spines, continuous but deeply notched between last 2 spines, 13-15; anal with IV spines, 3rd  spine stoutest, it or 4th  longest, 11-13 rays; tail forked; scales large, very rough;  lateral-line scales 28-31; 2.5 scale rows above lateral line; lower half of inner pectoral axil with small scales.



Silvery pink with red scale edges;  membrane at edge of gill cover black; upper pectoral axis black; spiny dorsal fin orange on outer half; all fins except pectorals with white tips.


Size: attains 31 cm.

Habitat: common at offshore island areas.

Depth: 1-160 m.

Widespread in the tropical Indo-Pacific from East Africa to the Americas; the tip of Baja, Costa Rica to Colombia and the offshore islands.
   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Inhabits caves and hides under ledges of subtidal reef flats, channels and margins to outer reef slopes (Ref. 9710, 58302). Benthopelagic (Ref. 58302). Occurs in loose aggregations (Ref. 9710). Feeds mainly on plankton such as crab larvae. Almost always caught at night (Ref. 9307). Marketed fresh (Ref. 9307). Minimum depth reported taken from Ref. 30874.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, TEP non-endemic, Indo-Pacific only (Indian + Pacific Oceans), "Transpacific" (East + Central &/or West Pacific), All Pacific (West + Central + East)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific and Eastern Pacific: East Africa south to Natal, South Africa (but not from the Red Sea) and east to the Clipperton, Cocos and Galapagos islands, north to the Ryukyu Islands and south to the Great Barrier Reef, Norfolk Island, and Lord Howe Island. Throughout Micronesia (Ref. 1602) and common throughout Oceania, being clearly absent only from Easter Island.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-Pacific: East Africa, South Africa, Seychelles, Madagascar and western Mascarenes east to Hawaiian Islands and Costa Rica, north to Ryukyu Islands, Ogasawara Islands and Midway Atoll, south to Western Australia at 22°S, Lord Howe Island, New
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth

Depth Range (m): 1 (S) - 160 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 11; Dorsal soft rays (total): 13 - 15; Analspines: 4; Analsoft rays: 11 - 13
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length max (cm): 31.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 300 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

30.0 cm TL (male/unsexed; (Ref. 4201))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Inhabits caves and hides under ledges of subtidal reef flats, channels and margins to outer reef slopes at depths of at least 50 m. Occurs in loose aggregations in or near shelter during the day (Ref. 9710). Feeds mainly on plankton such as crab larvae. Almost always caught at night (Ref. 9307). Marketed fresh (Ref. 9307).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lower jaw of adults prominently projecting when mouth is closed. Lower half to three-fourths of inner pectoral axil with small scales. Centers of scales silvery pink to pale yellowish, the edges red; black of opercular membrane extending below opercular spine; naked part of pectoral axil black; outer half of spinous dorsal fin yellow to orange-yellow, lower half of remaining fins red, the leading edges white, sometimes with a black submarginal streak.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Myripristis berndti Jordan & Evermann
Catalog Number: USNM 50627
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan & B. Evermann
Locality: Honolulu, Hawaii, Oahu, Hawaii, United States, Hawaiian Islands, Pacific
  • Type: Jordan, D. S. & Evermann, B. W. 1903. Bulletin of the United States Fish Commission. 22 (for 1902): 171.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cotype for Myripristis berndti Jordan & Evermann
Catalog Number: USNM 125645
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1901
Locality: Hawaii, United States, Hawaiian Islands, Pacific
  • Cotype: Jordan, D. S. & Evermann, B. W. 1903. Bulletin of the United States Fish Commission. 22 (for 1902): 171.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 1 - 50 m (Ref. 9710), usually 3 - 15 m (Ref. 4201)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 93 specimens in 1 taxon.
Water temperature and chemistry ranges based on 45 samples.

Environmental ranges
  Depth range (m): 1.75 - 132
  Temperature range (°C): 22.496 - 29.037
  Nitrate (umol/L): 0.019 - 5.562
  Salinity (PPS): 32.200 - 35.552
  Oxygen (ml/l): 4.243 - 5.079
  Phosphate (umol/l): 0.100 - 0.628
  Silicate (umol/l): 0.897 - 4.989

Graphical representation

Depth range (m): 1.75 - 132

Temperature range (°C): 22.496 - 29.037

Nitrate (umol/L): 0.019 - 5.562

Salinity (PPS): 32.200 - 35.552

Oxygen (ml/l): 4.243 - 5.079

Phosphate (umol/l): 0.100 - 0.628

Silicate (umol/l): 0.897 - 4.989
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 50m.
From 1 to 50 meters.

Habitat: reef-associated. Bigscale soldier.  Attains 30 cm.  Inhabits caves and hides under ledges of subtidal reef flats, channels and margins to outer reef slopes. Occurs in loose aggregations. Feeds mainly on plankton such as crab larvae. Almost always caught at night . Marketed fresh.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Near Bottom, Bottom, Bottom + water column

Habitat: Reef (rock &/or coral), Reef only, Rocks, Corals, Reef associated (reef + edges-water column & soft bottom)

FishBase Habitat: Reef Associated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits caves and hides under ledges of subtidal reef flats, channels and margins to outer reef slopes (Ref. 9710). Occurs in loose aggregations (Ref. 9710). Feeds mainly on plankton such as crab larvae. Planktivore (Ref. 57615). Almost always caught at night (Ref. 9307). Also Ref. 58534.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Feeding

Feeding Group: Planktivore

Diet: Pelagic crustacea, zooplankton
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Myripristis berndti

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 25
Specimens with Barcodes: 52
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Myripristis berndti

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 17 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCGCTGATTTTTCTCAACCAACCACAAAGACATTGGCACCCTCTACTTAGTATTTGGCGCCTGAGCCGGGATGGTCGGCACCGCTCTAAGCCTTCTCATTCGAGCTGAGCTTAGCCAACCCGGAGCTCTTCTGGGCGAC---GACCAGATTTACAACGTAATCGTTACGGCACACGCATTTGTAATAATTTTCTTTATAGTAATGCCAATCATGATTGGAGGTTTCGGAAACTGACTTATCCCCCTGATGATCGGCGCCCCCGACATGGCATTCCCTCGAATAAACAACATGAGCTTCTGACTACTCCCTCCTTCCTTCCTACTCCTCCTGGCCTCCTCAGGGGTAGAAGCTGGGGCTGGAACAGGATGAACTGTCTACCCACCTCTAGCAGGAAACTTAGCCCACGCAGGAGCTTCCGTTGATCTAACCATCTTCTCACTTCATCTAGCTGGTATCTCCTCAATTCTAGGGGCCATCAACTTCATCACAACGATCATTAATATGAAACCTCCAGCCATCTCTCAATACCAAACACCTCTGTTTGTTTGAGCTGTTCTAATTACGGCTGTCCTTCTTCTTCTATCCCTCCCTGTCCTTGCTGCTGGCATTACCATGCTCCTAACCGATCGAAACCTAAACACCACCTTCTTCGACCCAGCTGGGGGTGGAGACCCAATCCTTTATCAACACCTGTTCTGATTCTTCGGCCACCCAGAAGTGTACATTCTTATTCTCCCCGGTTTCGGTATGATTTCCCACATCGTTGCCTACTACTCCGGCAAAAAAGAACCTTTCGGCTACATAGGAATGGTATGAGCCATGATAGCAATCGGCCTTCTAGGCTTTATTGTGTGAGCTCACCACATGTTTACAGTCGGAATGGACGTAGACACACGTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquarium: commercial
  • Miyasaka, A. 1993 A database on scientific and common names of fishes exported from Hawaii. The information was derived from the above mentioned database. A printout of the names is also available from the State of Hawaii, Department of Land and Natural Resources, 1151 Punchbowl Street, Honolulu, Hawaii. (Ref. 5358)   http://www.fishbase.org/references/FBRefSummary.php?id=5358&speccode=4306 External link.
  • Schneider, W. and F. Krupp 1995 Holocentridae. Candiles. p. 1182-1185. In W. Fischer, F. Krupp, W. Schneider, C. Sommer, K.E. Carpenter and V. Niem (eds.) Guia FAO para Identification de Especies para lo Fines de la Pesca. Pacifico Centro-Oriental. 3 Vols. FAO, Rome. (Ref. 9307)   http://www.fishbase.org/references/FBRefSummary.php?id=9307&speccode=13749 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Blotcheye soldierfish

Myripristis berndti, the Blotcheye soldierfish, is a species of soldierfish belonging to the family Holocentridae.

Physical description[edit]

Mixed-species aggregation of Myripristis berndti

This species grows to a length of 30 centimetres (12 in) TL. The body is oval and laterally compressed and the scales are quite large. The basic colour is silvery pink to pale yellowish, with red scale margins. The opercular membrane is black. The dorsal fin is large and spiny, ranging from yellow to orange-yellow. The other fins are red with white edges. The eyes are large, as this fish is mainly nocturnal. The lower jaw protrudes beyond the upper jaw when mouth is closed. They usually aggregate in mixed-species and mainly feed on plankton. This fish is a target of commercial fisheries and can also be found in the aquarium trade.

Distribution[edit]

Myripristis berndti is widespread in the Indian and Pacific Oceans.

Habitat[edit]

This species can be found on tropical reefs hiding in caves or under ledges, at depths of from 1 to 50 metres (3.3 to 160 ft).

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!