Overview

Comprehensive Description

Biology

Inhabits outer reef slopes, over rubble, algae, or coral (Ref. 9710). Swim close to the bottom and females swim in small groups. Males swim around them and often hurry from one area to another where there are groups of females. Some juveniles are secretive and often single or small groups amongst the rubble (Ref. 48636).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-West Pacific: western Indian Ocean to Fiji. Questionable record from Indonesia (Ref. 8631).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is found from Oman to Tanzania in Eastern Africa to western Thailand, including the Andaman Islands and northern Sumatra.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Chagos, Comores, Seychelles
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indian Ocean: Comoro Islands to Andaman Sea.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Maximum size: 70 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

8.0 cm TL (male/unsexed; (Ref. 11441))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Only the first dorsal soft ray prolonged in adults; penultimate dorsal soft ray of males 1.6-2.0 in HL; a single short dark stripe beneath pectoral fin (Ref. 41634).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Paratype for Paracheilinus mccoskeri Randall & Harmelin-Vivien
Catalog Number: USNM 215274
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): J. McCosker
Year Collected: 1975
Locality: Grand Comore, Comore Islands; N of Moroni Reef and Padina Bed In Front of Said Ibrahim'S Place 150 m Off Shore., Grande Comore Island, Comoros, Comoro Islands, Indian
Depth (m): 25 to 30
  • Paratype: Randall, J. E. & Harmelin-Vivien, M. 1977. Bulletin du Museum National d'Histoire Naturelle (Paris), 3eme Serie. Zoologie. (No. 306): 332-33.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine, usually 5 - 40 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species occurs along reef margins on rubble, algae or coral zones at about 20-40 m depth (Kuiter 2002), and also on outer reef slope from 12 to 35 m depth (Lieske and Myers 1994). Females gather in small groups and males swim around them, often moving from one area to another between groups of females, while small juveniles are secretive and often appear singly or in small groups amongst the rubble (Kuiter 2002).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 2 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 6.5 - 31

Graphical representation

Depth range (m): 6.5 - 31
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Paracheilinus mccoskeri

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTGTATCTAGTATTTGGTGCTTGAGCCGGAATGGTAGGCACGGCTTTAAGCTTACTAATCCGCGCTGAACTCAGCCAGCCTGGGGCCCTCCTTGGCGATGATCAGATCTATAACGTTATTGTAACCGCTCACGCCTTTGTTATAATCTTTTTTATAGTAATGCCCATTATAATTGGAGGATTCGGAAACTGGCTTATTCCTCTAATGATTGGAGCCCCAGATATAGCATTTCCCCGAATAAATAATATAAGCTTTTGACTGCTTCCCCCTTCTTTCCTTCTTCTCCTGGCCTCTTCTGGGGTAGAAGCAGGGGCTGGGACAGGGTGAACAGTATATCCCCCACTAGCAGGAAACTTGGCCCATGCTGGAGCGTCTGTTGACCTGACTATTTTTTCTCTTCATCTCGCAGGTATTTCCTCTATCTTAGGGGCAATTAACTTTATTACAACCATCATTAATATGAAGCCCCCCGCCATCTCACAGTACCAGACCCCTTTATTTGTTTGGGCCGTACTAATTACAGCTGTCCTTCTCCTTCTTTCGCTGCCCGTTCTTGCAGCCGGAATTACAATGCTTCTGACTGACCGGAATTTAAATACCACTTTCTTCGACCCTGCTGGTGGAGGAGACCCCATCCTTTACCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Paracheilinus mccoskeri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Liu, M. & To, A.

Reviewer/s
Craig, M.T. & Carpenter, K.E.

Contributor/s

Justification
This species is widepsread with little information available on population trends. There are no known major threats although it is collected for the aquarium trade. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There is no population information available for this species. It is common in the Seychelles.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
There are no major threats known to this species, although it is collected for the aquarium trade.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for this species. However, its distribution overlaps several marine protected areas within its range (Wood 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Paracheilinus mccoskeri

Paracheilinus mccoskeri is a Wrasse from the Indo-West Pacific. It occasionally makes its way into the aquarium trade. It grows to a size of 8 cm in length.

References


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!