Paracheilinus mccoskeri — Details

Mccosker's Flasher-wrasse learn more about names for this taxon

Overview

Comprehensive Description

Biology

Learn more about this article

Inhabits outer reef slopes, over rubble, algae, or coral (Ref. 9710). Swim close to the bottom and females swim in small groups. Males swim around them and often hurry from one area to another where there are groups of females. Some juveniles are secretive and often single or small groups amongst the rubble (Ref. 48636).

Randall, J.E. and R. Lubbock 1981 Labrid fishes of the genus Paracheilinus, with descriptions of three new species from the Philippines. Jap. J. Ichthyol. 28(1):19-30. (Ref. 2139) http://www.fishbase.org/references/FBRefSummary.php?id=2139&speccode=4842

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Distribution

Learn more about this article

Indo-West Pacific: western Indian Ocean to Fiji. Questionable record from Indonesia (Ref. 8631).

Randall, J.E. 1999 Paracheilinus attenuatus, a new labrid fish from the western Indian Ocean, with a redescription of P. piscilineatus . J. South Asian Nat. Hist. 4(1):29-38. (Ref. 41634) http://www.fishbase.org/references/FBRefSummary.php?id=41634&speccode=4842

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Range Description

Learn more about this article

This species is found from Oman to Tanzania in Eastern Africa to western Thailand, including the Andaman Islands and northern Sumatra.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Chagos, Comores, Seychelles

Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp. http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5909
Anon. (2000). FishBase 2000 [CD-ROM]. ICLARM: Los Baños, Laguna, Philippines. 4 cd-roms pp. http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6542

Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Indian Ocean: Comoro Islands to Andaman Sea.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Physical Description

Size

Learn more about this article

Maximum size: 70 mm NG

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Max. size

Learn more about this article

8.0 cm TL (male/unsexed; (Ref. 11441))

Randall, J.E. 1995 Coastal fishes of Oman. University of Hawaii Press, Honolulu, Hawaii. 439 p. (Ref. 11441) http://www.fishbase.org/references/FBRefSummary.php?id=11441&speccode=4740

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Diagnostic Description

Learn more about this article

Only the first dorsal soft ray prolonged in adults; penultimate dorsal soft ray of males 1.6-2.0 in HL; a single short dark stripe beneath pectoral fin (Ref. 41634).

Randall, J.E. 1999 Paracheilinus attenuatus, a new labrid fish from the western Indian Ocean, with a redescription of P. piscilineatus . J. South Asian Nat. Hist. 4(1):29-38. (Ref. 41634) http://www.fishbase.org/references/FBRefSummary.php?id=41634&speccode=4842

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Type Information

Learn more about this article

Paratype for Paracheilinus mccoskeri Randall & Harmelin-Vivien
Catalog Number: USNM 215274
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): J. McCosker
Year Collected: 1975
Locality: Grand Comore, Comore Islands; N of Moroni Reef and Padina Bed In Front of Said Ibrahim'S Place 150 m Off Shore., Grande Comore Island, Comoros, Comoro Islands, Indian
Depth (m): 25 to 30

Paratype: Randall, J. E. & Harmelin-Vivien, M. 1977. Bulletin du Museum National d'Histoire Naturelle (Paris), 3eme Serie. Zoologie. (No. 306): 332-33.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Ecology

Habitat

Environment

Learn more about this article

reef-associated; marine, usually 5 - 40 m (Ref. 27115)

Baensch, H.A. and H. Debelius 1997 Meerwasser atlas. Mergus Verlag GmbH, Postfach 86, 49302, Melle, Germany. 1216 p. 3rd edition. (Ref. 27115) http://www.fishbase.org/references/FBRefSummary.php?id=27115&speccode=4306

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Habitat and Ecology

Learn more about this article

Habitat and Ecology

This species occurs along reef margins on rubble, algae or coral zones at about 20-40 m depth (Kuiter 2002), and also on outer reef slope from 12 to 35 m depth (Lieske and Myers 1994). Females gather in small groups and males swim around them, often moving from one area to another between groups of females, while small juveniles are secretive and often appear singly or in small groups amongst the rubble (Kuiter 2002).

Systems

Marine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Depth range based on 2 specimens in 1 taxon.

Environmental ranges
Depth range (m): 6.5 - 31

Graphical representation

Depth range (m): 6.5 - 31

Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Public Domain

Source: Ocean Biogeographic Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Molecular Biology and Genetics

Molecular Biology

Barcode data: Paracheilinus mccoskeri

Learn more about this article

The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 5 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTGTATCTAGTATTTGGTGCTTGAGCCGGAATGGTAGGCACGGCTTTAAGCTTACTAATCCGCGCTGAACTCAGCCAGCCTGGGGCCCTCCTTGGCGATGATCAGATCTATAACGTTATTGTAACCGCTCACGCCTTTGTTATAATCTTTTTTATAGTAATGCCCATTATAATTGGAGGATTCGGAAACTGGCTTATTCCTCTAATGATTGGAGCCCCAGATATAGCATTTCCCCGAATAAATAATATAAGCTTTTGACTGCTTCCCCCTTCTTTCCTTCTTCTCCTGGCCTCTTCTGGGGTAGAAGCAGGGGCTGGGACAGGGTGAACAGTATATCCCCCACTAGCAGGAAACTTGGCCCATGCTGGAGCGTCTGTTGACCTGACTATTTTTTCTCTTCATCTCGCAGGTATTTCCTCTATCTTAGGGGCAATTAACTTTATTACAACCATCATTAATATGAAGCCCCCCGCCATCTCACAGTACCAGACCCCTTTATTTGTTTGGGCCGTACTAATTACAGCTGTCCTTCTCCTTCTTTCGCTGCCCGTTCTTGCAGCCGGAATTACAATGCTTCTGACTGACCGGAATTTAAATACCACTTTCTTCGACCCTGCTGGTGGAGGAGACCCCATCCTTTACCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Statistics of barcoding coverage: Paracheilinus mccoskeri

Learn more about this article

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Conservation

Conservation Status

IUCN Red List Assessment

Learn more about this article

Red List Category

LC

Least Concern

Red List Criteria

Version

3.1

Year Assessed

2010

Assessor/s

Liu, M. & To, A.

Reviewer/s

Craig, M.T. & Carpenter, K.E.

Contributor/s

Justification

This species is widepsread with little information available on population trends. There are no known major threats although it is collected for the aquarium trade. It is listed as Least Concern.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Trends

Population

Learn more about this article

Population

There is no population information available for this species. It is common in the Seychelles.

Population Trend

Unknown

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Threats

Learn more about this article

Least Concern (LC)

IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006. http://www.fishbase.org/references/FBRefSummary.php?id=57073

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Major Threats

There are no major threats known to this species, although it is collected for the aquarium trade.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Management

Conservation Actions

Learn more about this article

Conservation Actions

There are no species-specific conservation measures in place for this species. However, its distribution overlaps several marine protected areas within its range (Wood 2007).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Relevance to Humans and Ecosystems

Benefits

Importance

Learn more about this article

aquarium: commercial

Baensch, H.A. and H. Debelius 1997 Meerwasser atlas. Mergus Verlag GmbH, Postfach 86, 49302, Melle, Germany. 1216 p. 3rd edition. (Ref. 27115) http://www.fishbase.org/references/FBRefSummary.php?id=27115&speccode=4306

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Wikipedia

Paracheilinus mccoskeri

Learn more about this article

Paracheilinus mccoskeri is a Wrasse from the Indo-West Pacific. It occasionally makes its way into the aquarium trade. It grows to a size of 8 cm in length.

References

Froese, Rainer, and Daniel Pauly, eds. (2008). "Paracheilinus mccoskeri" in FishBase. December 2008 version.

This Labridae article is a stub. You can help Wikipedia by expanding it.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!