Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Inhabits lagoon, channel, or protected seaward reef slopes, drop offs, coral and rubble areas (Ref. 1602). Usually in pairs or in small groups. Feeds on algae, small crustaceans and worms. Darts from one hiding place to the next. Commonly exported through the aquarium trade (Ref. 48391).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is widely distributed from the Indo-Malayan region eastward across the tropical Pacific Ocean to the Line Islands, northward to southern Japan, and southward to New Caledonia (Pyle 2001). It is found at depths of 1-25 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: East Africa to the Samoan and Phoenix Islands, north to southern Japan, south to New Caledonia; throughout Micronesia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

West Pacific and eastern Indian Ocean.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 15; Dorsal soft rays (total): 15 - 17; Analspines: 3; Analsoft rays: 17 - 18
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 150 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

15.0 cm TL (male/unsexed; (Ref. 9710)); max. reported age: 13 years (Ref. 3420)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Inhabits lagoon, channel, or protected seaward reef slopes, drop offs, coral and rubble areas (Ref. 1602); usually in pairs or in small groups close to the bottom. Darts from one hiding place to the next. Feeds on algae, small crustaceans and worms. Frequently imported from the Philippines.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Juveniles similar to adult and easily recognized by their distinctive coloration (Ref. 48636). Head and anterior half of trunk yellow with a blue blotch over the eye. Posterior half of trunk and tail blue. Caudal fin yellow.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Areas of rich coral growth on seaward facing reefs, drop-offs and in lagoons. Also occurs in rubble areas. Most commonly observed between 3-20 m. Swims close to the bottom grazing on algae, but never strays far from shelter of reef crevices. Occurs singly, in pairs, or small aggregations (G.R. Allen pers. comm. 2006). Forms harems of three to seven individuals (Pyle 2001).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; non-migratory; marine; depth range 1 - 25 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 79 specimens in 1 taxon.
Water temperature and chemistry ranges based on 58 samples.

Environmental ranges
  Depth range (m): 0.5 - 59
  Temperature range (°C): 25.451 - 29.205
  Nitrate (umol/L): 0.019 - 1.279
  Salinity (PPS): 33.913 - 35.507
  Oxygen (ml/l): 4.336 - 4.812
  Phosphate (umol/l): 0.070 - 0.257
  Silicate (umol/l): 0.567 - 4.977

Graphical representation

Depth range (m): 0.5 - 59

Temperature range (°C): 25.451 - 29.205

Nitrate (umol/L): 0.019 - 1.279

Salinity (PPS): 33.913 - 35.507

Oxygen (ml/l): 4.336 - 4.812

Phosphate (umol/l): 0.070 - 0.257

Silicate (umol/l): 0.567 - 4.977
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 25m.
From 1 to 25 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits lagoon, channel, or protected seaward reef slopes, drop offs, coral and rubble areas. Usually in pairs or in small groups. Feeds on algae, small crustaceans and worms.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Pelagic spawner. Sex reversal is completed in 18-20 days (Ref. 34185, 34248).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Centropyge bicolor

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATCTANTATTTGGTGCTTGAGCTGGGATGGTAGGAACCGCTCTAAGCCTACTTATTCGAGCAGAACTCAATCAGCCAGGAAGCCTCCTAGGAGACGACCAGATTTATAATGTAATCGTAACAGCACATGCATTTGTTATAATCTTCTTTATAGTTATACCCGCTATGATTGGAGGATTCGGAAACTGACTGATCCCTCTGATGATCGGAGCTCCCGATATAGCATTTCCACGAATAAACAACATAAGCTTCTGACTCCTCCCCCCTTCCCTTCTGCTTCTCCTCGCTTCTGCAGGTGTAGAAGCTGGGGCCGGAACTGGCTGAACAGTTTATCCCCCTCTAGCCGGCAATCTCGCCCATGCGGGGGCATCCGTGGATCTAACTATTTTTTCCCTTCATCTAGCAGGGATCTCCTCAATTTTAGGAGCTATTAACTTTATTACCACCATCATCAACATAAAACCCCCAGCCATTTCCCAATACCAAACACCACTCTTCGTTTGGGCAGTACTAATTACTGCTGTCCTCCTACTCCTCTCCCTTCCGGTCCTTGCTGCTGGGATTACAATACTCCTTACAGACCGAAATCTAAACACCACCTTCTTTGACCCCGCAGGAGGAGGGGACCCAATTCTCTATCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Centropyge bicolor

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 18
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Pyle, R., Myers, R. & Rocha, L.A.

Reviewer/s
Elfes, C., Polidoro, B., Livingstone, S. & Carpenter, K.E.

Contributor/s

Justification

Listed as Least Concern in view of its wide distribution, large overall population, collection for the aquarium fish trade is not globally impacting the population, and there are no other potential major threats.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Populations are stable and common throughout most of its range, but it is rare at Palau to the eastern Caroline Islands, Marianas Islands, and Marshall islands (G.R. Allen pers. comm. 2006). Vagrant to the Line Islands (single specimen collected at Christmas Island, Kiribati). It is a common species at New Guinea and on the Great Barrier Reef (Steene 1978).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats

There appear to be no major threats to this species. Although it is often collected for the aquarium trade, harvest levels are not considered to be impacting the global population. There is no substantial habitat loss in the range of this species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no known species-specific conservation measures currently in place for this species. It is found in several marine protected areas.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: subsistence fisheries; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Bicolor angelfish

The bicolor angelfish (Centropyge bicolor, also known as Oriole Angelfish) is a marine angelfish, with an easily recognisable yellow front and a dark blue rear completed with a yellow tail. This species is widely distributed in the South Pacific. The bicolor angel fish has a maximum size at just under 15 cm making it a relatively large member of the Centropyge (Dwarf Angelfish) genus.

Despite being favored by many aquarists, the bicolor angelfish can be very difficult to keep, even experts often find it difficult to keep them beyond an initial acclimatisation period.

  • Distribution: Indo-Pacific
  • Adult Size: 6 inches (15.2cm)
  • Minimum Tank Size: 55 gallons
  • Temperament: Timid and skittish

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!