Overview

Comprehensive Description

Biology

Found in slow flowing rivers and standing waters (Ref. 557). Apparently restricted to reedy habitats (Ref. 42768). It moves snake-wise over the bottom, but it can also side-wind quite rapidly through the water (Ref. 42873). Feeds at night on worms, crustaceans and insects (Ref. 7020). Able to breathe air and thus can tolerate low oxygen concentrations. Larvae have external gills and resemble salamander larvae (Ref. 557). The size of 90 cm TL (Ref. 3188) is not confirmed; largest size in collections is 37 cm (Ref. 78138).
  • Gosse, J.-P. 1990 Polypteridae. p. 79-87. In C. Lévêque, D. Paugy and G.G. Teugels (eds.) Faune des poissons d'eaux douces et saumâtres d'Afrique de l'Ouest. Tome 1. Coll. Faune Trop. n° XXVIII. Musée Royal de l'Afrique Centrale, Tervuren and Éditions de l'ORSTOM, Paris. 384 p. (Ref. 2835)   http://www.fishbase.org/references/FBRefSummary.php?id=2835&speccode=2385 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is known from Benin to Gabon.

Central Africa: In Lower Guinea, Erpetoichthys calabaricus is known from coastal rivers of Cameroon to the Sanaga. Boulenger's (1909) record of E. calabaricus from the Chiloango in Congo needs further corroboration (see Teugels et al. 1992).

Western Africa: It is present in the Ouémé (Benin), Ogun and Cross Rivers (Nigeria)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Erpetoichthys calabaricus is distributed solely in tropical Africa, where it occupies habitats ranging from flowing rivers to flood plains and internal river deltas.

Biogeographic Regions: ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Africa: Ogun River mouth in Nigeria to Chiloango River in Congo Brazzaville (Ref. 2835).
  • Gosse, J.-P. 1990 Polypteridae. p. 79-87. In C. Lévêque, D. Paugy and G.G. Teugels (eds.) Faune des poissons d'eaux douces et saumâtres d'Afrique de l'Ouest. Tome 1. Coll. Faune Trop. n° XXVIII. Musée Royal de l'Afrique Centrale, Tervuren and Éditions de l'ORSTOM, Paris. 384 p. (Ref. 2835)   http://www.fishbase.org/references/FBRefSummary.php?id=2835&speccode=2385 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Erpetoichthys calabaricus has a snake-like appearance, with a yellow ventral surface and greenish black dorsal surface. This species has specialized scales, which are called ganoid scales, and it has nostrils or nares on tentacles that protrude from the head. Also on the head are passive electroreceptive organs(ampullae). This species also has one-rayed dorsal finlets instead of a singular dorsal fin.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dorsal spines (total): 7 - 13; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 9 - 14; Vertebrae: 110 - 113
  • Gosse, J.-P. 1990 Polypteridae. p. 79-87. In C. Lévêque, D. Paugy and G.G. Teugels (eds.) Faune des poissons d'eaux douces et saumâtres d'Afrique de l'Ouest. Tome 1. Coll. Faune Trop. n° XXVIII. Musée Royal de l'Afrique Centrale, Tervuren and Éditions de l'ORSTOM, Paris. 384 p. (Ref. 2835)   http://www.fishbase.org/references/FBRefSummary.php?id=2835&speccode=2385 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 900 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

37.0 cm TL (male/unsexed; (Ref. 78138))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Body elongate and anguilliform (Ref. 42768, Ref. 42908). Body height 24 times in total length; head length 11-14 times in total length (Ref. 2835). Head without sub-operculars, very slightly flattened, 1.6-2 times longer than wide; upper jaw prominent (Ref. 2835). Lateral eyes, eye-diameter 7.5-8.5 times in head length (Ref. 2835). Dorsal fin is composed of a series of well-separated spines each supporting one or several articulated rays and a membrane (Ref. 42791). Body covered with rhombic ganoid scales (Ref. 42791). 106-114 perforated scales on longitudinal line; 30-34 around body (Ref. 2835). Brown-olive colored on dorsal part and whitish on ventral portion, a big black spot on pectoral fins (Ref. 2835).
  • Gosse, J.-P. 1990 Polypteridae. p. 79-87. In C. Lévêque, D. Paugy and G.G. Teugels (eds.) Faune des poissons d'eaux douces et saumâtres d'Afrique de l'Ouest. Tome 1. Coll. Faune Trop. n° XXVIII. Musée Royal de l'Afrique Centrale, Tervuren and Éditions de l'ORSTOM, Paris. 384 p. (Ref. 2835)   http://www.fishbase.org/references/FBRefSummary.php?id=2835&speccode=2385 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is a freshwater species also found in brackish coastal waters. It prefers slow flowing rivers and standing waters. Apparently restricted to reedy habitats, and feeds at night on worms crustaceans and other insects. It is able to breath air and can tolerate low oxygen concentrations.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Erpetoichthys calabaricus resides in the muddy/silty rivers of Africa, where, because of the muddy water, there is poor visibility.

Aquatic Biomes: rivers and streams

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

demersal; freshwater; brackish; pH range: 6.0 - 8.0; dH range: 5 - 19; depth range 0 - ? m (Ref. 557)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Erpetoichthys clabaricus is an omnivore. While it mainly feeds on small crustaceans, insects, and small fish, it will also sometimes feed on dead organisms and algae or other plant materials.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Erpetoichthys is apparently restricted to reedy habitats (Ref. 42768). Found near river mouths; feeds at night on worms, crustaceans and insects (Ref. 7020).
  • Gosse, J.-P. 1990 Polypteridae. p. 79-87. In C. Lévêque, D. Paugy and G.G. Teugels (eds.) Faune des poissons d'eaux douces et saumâtres d'Afrique de l'Ouest. Tome 1. Coll. Faune Trop. n° XXVIII. Musée Royal de l'Afrique Centrale, Tervuren and Éditions de l'ORSTOM, Paris. 384 p. (Ref. 2835)   http://www.fishbase.org/references/FBRefSummary.php?id=2835&speccode=2385 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Bacterial Infections (general). Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Parallel swimming courtship; female deposits few eggs between anal fins of male, where they are fertilized and then scattered in vegetation where they immediately stick to substrate. This procedure is repeated many times. Eggs are 2.1-2.6 mm in diameter. Larvae hatch after 70 hours but remain attached to vegetation; 22 days after hatching the yolk sac is absorbed and larvae start feeding.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Erpetoichthys calabaricus has external fertilization of eggs with sperm.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Erpetoichthys calabaricus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGC0237-06|AJ584641|Erpetoichthys calabaricus| ACCCGCTGATTATTCTCAACAAACCATAAAGACATTGGCACCCTTTATCTGATCTTCGGTGCTTGAGCCGGAATGGTAGGTACTGCATTA---AGCCTACTTATTCGTGCAGAACTTGGACAACCGGGAGCCTTAATAGGTGAC---GACCAAATTTATAACGTTATTGTTACTGCCCATGCATTCGTAATAATCTTCTTTATAGTAATGCCGATCATAATCGGCGGCTTCGGCAACTGATTAGTGCCATTAATA---ATTGGAGCGCCAGATATGGCATTCCCACGAATAAATAATATAAGCTTTTGACTACTTCCCCCCTCATTCCTGCTTTTATTAACATCGTCTGCAGTAGAAGCTGGTGTAGGAACCGGCTGAACTGTATACCCACCACTAGCAGGCAACTTAGCTCATGCGGGGGCATCAGTTGATTTA---GCTATCTTTTCATTACATTTGGCTGGAGTATCTTCCATTCTAGGAGCTATTAATTTTATCACCACAATTATTAACATAAAACCACCAGCTACCTCACAATATCAAACACCTTTATTTGTATGATCTGTCCTTGTTACTGCGGTATTATTACTACTATCACTCCCAGTATTAGCAGCT---GGTATTACTATACTATTAACAGACCGAAACCTTAACACAACATTTTTTGACCCTGCTGGAGGAGGAGACCCTATTCTCTATCAACATTTGTTCTGATTCTTCGGTCACCCAGAAGTCTACATTCTTATTCTCCCTGGATTTGGTATAATTTCCCATATTGTAGCCTACTATTCAGGTAAAAAT---GAACCCTTTGGTTATATGGGAATAGTCTGAGCTATAATAGCAATCGGGCTTTTAGGCTTTATTGTATGAGCACATCATATGTTTACAGTGGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Erpetoichthys calabaricus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Species: 6
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Lalèyè, P., Moelants, T. & Olaosebikan, B.D.

Reviewer/s
Snoeks, J., Tweddle, D., Getahun, A., Lalèyè, P., Paugy, D., Zaiss, R., Fishar, M.R.A & Brooks, E.

Contributor/s

Justification
This species is known from four River systems, and greater than five localities but fewer than 10. The EOO is less than 20,000 km2. The species is threatened by the oil palm plantations in the coastal region. There is ongoing habitat degradation and loss due to deforestation, agriculture and urban development. However it is thought that this species will be fairly resilient to habitat change. If the species was found to be impacted by these threats, it may meet the qualifications for Vulnerable B1abiii, but it is currently assessed as Near Threatened. It is assessed as Vulnerable in western Africa, and as Endangered in central Africa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Erpetoichthys calabaricus is not endangered, although it is limited to a fairly small number of rivers.

IUCN Red List of Threatened Species: near threatened

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
No information available.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
The species is threatened by the oil palm plantations in the coastal regions of central Africa. In western Africa, it is threatened by habitat degradation/loss due to wetland drainage for agriculture and urban developments and deforestation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Near Threatened (NT)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
None known. More research is needed into this species range, and population trends should be monitored.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

Erpetoichthys calabaricus is used in the small pet trade.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Importance

fisheries: of no interest; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Reedfish

The Reedfish, Erpetoichthys calabaricus, Ropefish (a name more commonly used in the United States), or Snakefish is a species of freshwater fish in the bichir family and order. It is the only member of the genus Erpetoichthys. It is native to West Africa, with its natural habitat stretching from Nigeria to The Congo.

The Reedfish has a maximum total length of 37 centimetres (14.5 inches). It lives in slow-moving, brackish or fresh water[citation needed], warm water (22-28 °C), and it can breathe atmospheric air (meaning it is able to survive in water with low dissolved oxygen content) using a pair of lungs. This organ means it can survive for an intermediate amount of time out of water. The Reedfish is a nocturnal creature that feeds on annelid worms, crustaceans and insects at night, and it is sometimes displayed in aquariums. Its genus name, Erpetoichthys, derives from the Greek words erpeton ("creeping thing") and ichthys ("fish"). The genus is also known by the name Calamoichthys.[1]

Contents

In the aquarium

Ropefish amongst Polypterus senegalus

Reedfish are inquisitive, peaceful, and have some "personality." Since they have a peaceful nature other fish may 'bully' a reedfish, despite its large size, especially if there is competition in the fish tank for food or space. They have been known to jump out of aquariums and slither around. This is because they have a pair of lungs along with their gills. Although nocturnal, reedfish will sometimes come out during the day, and this can be encouraged by daytime feeding of bloodworms or nightcrawlers for larger fish. Some Reedfish also have an inclination to stay close to the water surface where it will be safe from other fish and will even allow most of its body to leave the water at times. An easy way to test if your reedfish has the need is to put a breeding tank with a cover on the side of the tank, it will soon nestle himself on top if it if need be. The fish are notorious escape artists and can jump a great distance, so the aquarium should have a tightly-fitting lid without large holes; many novice fishkeepers have rescued their reedfish from desiccation after finding their Reedfish on the floor only just alive. Dust, common on most household floors, can easily dry out a reedfish before it is rescued. It is best to reduce the water level if it is not possible to completely seal the tank. Reedfish escape most often during the night when they are most active.

Feeding and care

In captivity the reedfish will readily accept bloodworms and most other frozen foods that sink to the bottom of the tank. If kept with other fast eating fish it is best to put the Reedfish's food in a narrow tube which only he would be able to enter, or feed it bloodworms by hand. He will find the food by smell. If this setup is kept in the same spot in the tank he would soon learn where to find food when he is hungry. They tolerate their own species and can often be found nestled together behind or under plants and/or decorations, especially ornaments such as 'caves' because they feel sheltered and safe. Maintaining a healthy tank environment is not especially difficult as the reed fish is quite hardy- its tough scales will stay mainly intact even if it jumps out of a tank. Water temperature should be between 22 and 28 °C (72 and 83 °F) with 6.5-7.5 pH levels. Providing hiding places to reduce stress will also be appreciated. Juveniles can be kept in a 75 liter (20 US gallon) tank, but adults will need more space due to their size and eating habits. Although there have been people that have had adults in tanks smaller than 100L, they do better in big tanks. The water does not have to be especially clean and pure as a reedfish's natural habitat is often eutrophic and low in oxygen, yet other fish in the tank may not be compatible with slightly unclean water.

See also

References

  1. ^ L. Fishelson, Zoology, renewed and corrected ed. 1984, Hakibutz Hameuchad Pub. House, Israel 1984. Vol II, p.126 (Hebrew)
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!