Overview

Comprehensive Description

Biology

Found near prominent current-swept lagoon or seaward reefs (Ref. 9710); also in bays, estuaries and turbid inner lagoons (Ref. 9768). Diurnal and solitary, although the young form schools. Feeds mainly on fishes but also takes squid. Sold fresh, frozen or dried salted. Reports of ciguatera poisoning need confirmation.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Djibouti, East Africa, Eritrea, Gazi Bay, Kenya, Madagascar, Mauritius, Mozambique, Mtwapa, Red Sea, Seychelles, Somalia, South Africa (country), Tanzania, Ungama Bay
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific: Red Sea (Ref. 12541) south to the southeastern coast of South Africa and east to New Caledonia and Vanuatu. Recently reported from Tonga (Ref. 53797). Due to a widespread confusion with Sphyraena putnamae and Sphyraena qenie, the exact range is uncertain.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red Sea, Indo-West Pacific: Gulf of Aden, East Africa, KwaZulu-Natal (South Africa), Madagascar and Mauritius (Mascarenes) east to Fiji and Tonga, north to Taiwan, south to Western Australia, New South Wales (Australia) and New Caledonia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 6; Dorsal soft rays (total): 9; Analspines: 2; Analsoft rays: 7 - 9
  • Senou, H. 2001 Sphyraenidae. Barracudas. p. 3685-3697. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9768)   http://www.fishbase.org/references/FBRefSummary.php?id=9768&speccode=5734 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 1500 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

150 cm TL (male/unsexed; (Ref. 2871)); max. published weight: 11.5 kg (Ref. 40637)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Body with dark bars crossing lateral line, each bar oblique in upper half, but nearly vertical in lower half; caudal fin largely yellowish.
  • Senou, H. 2001 Sphyraenidae. Barracudas. p. 3685-3697. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9768)   http://www.fishbase.org/references/FBRefSummary.php?id=9768&speccode=5734 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Inhabits bays, estuaries and turbid inner lagoons (Ref. 9768). Diurnal and solitary, although the young forms schools. Feeds mainly on fishes, also squid. Also caught with set nets (Ref. 9768). Sold fresh, frozen or dried salted in markets. Claims of ciguatera poisoning by eating this fish need confirmation.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; oceanodromous (Ref. 51243); brackish; marine; depth range 20 - 200 m (Ref. 28016)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 84 specimens in 1 taxon.
Water temperature and chemistry ranges based on 22 samples.

Environmental ranges
  Depth range (m): 0.5 - 140
  Temperature range (°C): 20.420 - 28.199
  Nitrate (umol/L): 0.154 - 10.882
  Salinity (PPS): 32.916 - 35.468
  Oxygen (ml/l): 2.877 - 4.932
  Phosphate (umol/l): 0.081 - 1.043
  Silicate (umol/l): 0.567 - 17.115

Graphical representation

Depth range (m): 0.5 - 140

Temperature range (°C): 20.420 - 28.199

Nitrate (umol/L): 0.154 - 10.882

Salinity (PPS): 32.916 - 35.468

Oxygen (ml/l): 2.877 - 4.932

Phosphate (umol/l): 0.081 - 1.043

Silicate (umol/l): 0.567 - 17.115
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 20 - 200m.
From 20 to 200 meters.

Habitat: reef-associated. Found near prominent current-swept lagoon or seaward reefs (Ref. 9710); also in bays, estuaries and turbid inner lagoons (Ref. 9768). Diurnal and solitary, although the young form schools. Feeds mainly on fishes but also takes squid. Sold fresh, frozen or dried salted. Reports of ciguatera poisoning need confirmation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Juveniles occur in mangroves and brackishwaters as nursery grounds; adults inhabit reefs and shallow waters (Ref. 43081).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Pseudopecoeloides Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sphyraena jello

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTACCTACTATTTGGCGCCTGGGCTGGGATGGTAGGTACAGCTCTAAGCCTACTTATTCGAGCCGAACTTAGTCAACCGGGCTCTCTCTTAGGAGACGACCAAATTTATAATGTTATCGTAACAGCACACGCCTTTGTAATAATCTTTTTTATGGTAATACCCATTATGATTGGGGGCTTTGGGAACTGACTTATTCCCCTAATAATTGGCGCTCCAGACATAGCATTCCCCCGAATAAATAATATAAGCTTTTGACTACTCCCCCCTTCCTTTCTCTTACTCCTTTCTTCTTCGGCTGTAGAAGCGGGGGCCGGGACAGGATGGACAGTTTATCCTCCCTTAGCTGGAAATTTGGCCCATGCAGGAGCATCCGTCGACCTAACCATTTTCTCCCTTCACCTGGCAGGTATTTCTTCAATCCTAGGGGCTATTAATTTTATTACCACTATTATTAACATGAAACCAGCGGCGACTTCAATGTACCAAATTCCTCTGTTCGTTTGGGCTGTACTAATCACTGCCGTTCTCCTTCTCCTTTCACTCCCTGTCTTAGCTGCTGGTATTACAATGCTCTTGACAGATCGAAATCTAAACACCGCCTTCTTTGACCCAGCAGGAGGAGGAGACCCCATTCTGTACCAGCACTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Sphyraena jello

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at Ocean Genome Legacy
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Pickhandle barracuda

The pickhandle barracuda (Sphyraena jello) is so called because the dark marks along its sides look like the thick ends of pickaxe handles.

Sea anglers sometimes colloquially shorten the name to "pick".

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!