Overview
Comprehensive Description
Biology
Found near prominent current-swept lagoon or seaward reefs (Ref. 9710); also in bays, estuaries and turbid inner lagoons (Ref. 9768). Diurnal and solitary, although the young form schools. Feeds mainly on fishes but also takes squid. Sold fresh, frozen or dried salted. Reports of ciguatera poisoning need confirmation.
-
De Sylva, D.P. and F. Williams 1986 Sphyraenidae. p. 721-726. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 5491)
http://www.fishbase.org/references/FBRefSummary.php?id=5491&speccode=16905
Trusted
Distribution
Djibouti, East Africa, Eritrea, Gazi Bay, Kenya, Madagascar, Mauritius, Mozambique, Mtwapa, Red Sea, Seychelles, Somalia, South Africa (country), Tanzania, Ungama Bay
-
MacNae, W. & M. Kalk (eds) (1958). A natural history of Inhaca Island, Mozambique. Witwatersrand Univ. Press, Johannesburg. I-iv, 163 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6266
-
Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5909
-
Randall, J.E. (1992). Red Sea Reef Fishes. Immel Publishing.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6091
-
Anon. (2000). FishBase 2000 [CD-ROM]. ICLARM: Los Baños, Laguna, Philippines. 4 cd-roms pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6542
-
Smith, J.L.B. & M.M. Smith (1963). The fishes of Seychelles. Department of Ichthyology, Rhodes University. Grahamstown.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5926
-
Grove, S.J., M.C. Little & P.J. Reay (1986). Tudor Creek Mombasa: the early life-history stages of fish and prawns 1985. Report of Overseas Development Administration Research Project R3888
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6037
-
Fulanda, B.; Ohtomi, J.; Mueni, E.; Kimani, E. (2011). Fishery trends, resource-use and management system in the Ungwana Bay fishery Kenya. Ocean & Coastal Management, vol. 54, no. 5, pp. 401-414.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=166289
-
Hemminga, M.A.; Gwada, P.; Slim, F.J.; Dekoeyer, P.; Kazungu, J. (1995). Leaf production and nutrient contents of the seagrass Thalassodendron ciliatum in the proximity of a mangrove forest (Gazibay, Kenya). Aquat. Bot. 50(2): 159-170.
http://www.vliz.be/vmdcdata/mangroves/aphia.php?p=sourcedetails&id=166297
-
Huxham, Mark, Kimani, E and Augley, J (2004) Mangrove fish: a comparison of community structure between forested and cleared habitats. Estuarine Coastal and Shelf Science, 60 (4). pp. 637-647.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=166298
-
Kimani, E.N.; Mwatha, G.K.; Wakwabi, E.O.; Ntiba, J.M.; Okoth, B.K. (1996). Fishes of a shallow tropical mangrove estuary, Gazi, Kenya. Mar. Fish. Inf. Serv. Tech. Ext. Ser. 47: 857-868.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=166290
-
Huxham, M., Kimani, E. & Augley, J. 2008. The Fish Community of an East African Mangrove: Effects of Turbidity and Distance from the Sea. Western Indian Ocean Journal of Marine Science, 7, 57-67.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=166307
-
M.C Little, P.J. Reay and S.J. Grove. The fish community of an East African mangrove creek. J.Fish Biol. (1988) 32, 729-747.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=166399
Trusted
Indo-West Pacific: Red Sea (Ref. 12541) south to the southeastern coast of South Africa and east to New Caledonia and Vanuatu. Recently reported from Tonga (Ref. 53797). Due to a widespread confusion with Sphyraena putnamae and Sphyraena qenie, the exact range is uncertain.
-
De Sylva, D.P. and F. Williams 1986 Sphyraenidae. p. 721-726. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 5491)
http://www.fishbase.org/references/FBRefSummary.php?id=5491&speccode=16905
Trusted
Red Sea, Indo-West Pacific: Gulf of Aden, East Africa, KwaZulu-Natal (South Africa), Madagascar and Mauritius (Mascarenes) east to Fiji and Tonga, north to Taiwan, south to Western Australia, New South Wales (Australia) and New Caledonia.
Trusted
Physical Description
Morphology
Dorsal spines (total): 6; Dorsal soft rays (total): 9; Analspines: 2; Analsoft rays: 7 - 9
-
Senou, H. 2001 Sphyraenidae. Barracudas. p. 3685-3697. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9768)
http://www.fishbase.org/references/FBRefSummary.php?id=9768&speccode=5734
Trusted
Size
Max. size
150 cm TL (male/unsexed; (Ref. 2871)); max. published weight: 11.5 kg (Ref. 40637)
-
IGFA 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA. (Ref. 40637)
http://www.fishbase.org/references/FBRefSummary.php?id=40637&speccode=943
-
Bianchi, G. 1985 FAO species identification sheets for fishery purposes. Field guide to the commercial marine and brackish-water species of Tanzania. Prepared and published with the support of TCP/URT/4406 and FAO (FIRM) Regular Programme. FAO, Rome. 199 p. (Ref. 2871)
http://www.fishbase.org/references/FBRefSummary.php?id=2871&speccode=5538
Trusted
Diagnostic Description
Body with dark bars crossing lateral line, each bar oblique in upper half, but nearly vertical in lower half; caudal fin largely yellowish.
-
Senou, H. 2001 Sphyraenidae. Barracudas. p. 3685-3697. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9768)
http://www.fishbase.org/references/FBRefSummary.php?id=9768&speccode=5734
Trusted
Description
Inhabits bays, estuaries and turbid inner lagoons (Ref. 9768). Diurnal and solitary, although the young forms schools. Feeds mainly on fishes, also squid. Also caught with set nets (Ref. 9768). Sold fresh, frozen or dried salted in markets. Claims of ciguatera poisoning by eating this fish need confirmation.
-
Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5909
Trusted
Ecology
Habitat
Environment
reef-associated; oceanodromous (Ref. 51243); brackish; marine; depth range 20 - 200 m (Ref. 28016)
-
Al Sakaff, H. and M. Esseen 1999 Occurrence and distribution of fish species off Yemen (Gulf of Aden and Arabian Sea). Naga ICLARM Q. 22(1):43-47. (Ref. 28016)
http://www.fishbase.org/references/FBRefSummary.php?id=28016&speccode=1255
-
Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
http://www.fishbase.org/references/FBRefSummary.php?id=51243&speccode=4683
Trusted
Depth range based on 84 specimens in 1 taxon.
Water temperature and chemistry ranges based on 22 samples.
Environmental ranges
Depth range (m): 0.5 - 140
Temperature range (°C): 20.420 - 28.199
Nitrate (umol/L): 0.154 - 10.882
Salinity (PPS): 32.916 - 35.468
Oxygen (ml/l): 2.877 - 4.932
Phosphate (umol/l): 0.081 - 1.043
Silicate (umol/l): 0.567 - 17.115
Graphical representation
Depth range (m): 0.5 - 140
Temperature range (°C): 20.420 - 28.199
Nitrate (umol/L): 0.154 - 10.882
Salinity (PPS): 32.916 - 35.468
Oxygen (ml/l): 2.877 - 4.932
Phosphate (umol/l): 0.081 - 1.043
Silicate (umol/l): 0.567 - 17.115
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 22 samples.
Environmental ranges
Depth range (m): 0.5 - 140
Temperature range (°C): 20.420 - 28.199
Nitrate (umol/L): 0.154 - 10.882
Salinity (PPS): 32.916 - 35.468
Oxygen (ml/l): 2.877 - 4.932
Phosphate (umol/l): 0.081 - 1.043
Silicate (umol/l): 0.567 - 17.115
Graphical representation
Depth range (m): 0.5 - 140
Temperature range (°C): 20.420 - 28.199
Nitrate (umol/L): 0.154 - 10.882
Salinity (PPS): 32.916 - 35.468
Oxygen (ml/l): 2.877 - 4.932
Phosphate (umol/l): 0.081 - 1.043
Silicate (umol/l): 0.567 - 17.115
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Depth: 20 - 200m.
From 20 to 200 meters.
Habitat: reef-associated. Found near prominent current-swept lagoon or seaward reefs (Ref. 9710); also in bays, estuaries and turbid inner lagoons (Ref. 9768). Diurnal and solitary, although the young form schools. Feeds mainly on fishes but also takes squid. Sold fresh, frozen or dried salted. Reports of ciguatera poisoning need confirmation.
From 20 to 200 meters.
Habitat: reef-associated. Found near prominent current-swept lagoon or seaward reefs (Ref. 9710); also in bays, estuaries and turbid inner lagoons (Ref. 9768). Diurnal and solitary, although the young form schools. Feeds mainly on fishes but also takes squid. Sold fresh, frozen or dried salted. Reports of ciguatera poisoning need confirmation.
Trusted
Migration
Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
-
Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
http://www.fishbase.org/references/FBRefSummary.php?id=51243&speccode=4683
Trusted
Trophic Strategy
Juveniles occur in mangroves and brackishwaters as nursery grounds; adults inhabit reefs and shallow waters (Ref. 43081).
-
Schuster, W.H. 1960 Synopsis of biological data on milkfish Chanos chanos (Forsskål), 1775. FAO Fish. Biol. Synop. (4):pag. var. (Ref. 49)
http://www.fishbase.org/references/FBRefSummary.php?id=49&speccode=80
Trusted
Diseases and Parasites
Pseudopecoeloides Infestation. Parasitic infestations (protozoa, worms, etc.)
-
Arthur, J.R. and S. Lumanlan-Mayo 1997 Checklist of the parasites of fishes of the Philippines. FAO Fish. Tech. Pap. 369, 102 p. FAO, Rome. (Ref. 26129)
http://www.fishbase.org/references/FBRefSummary.php?id=26129&speccode=1258
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Sphyraena jello
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 5 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 5 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
CCTCTACCTACTATTTGGCGCCTGGGCTGGGATGGTAGGTACAGCTCTAAGCCTACTTATTCGAGCCGAACTTAGTCAACCGGGCTCTCTCTTAGGAGACGACCAAATTTATAATGTTATCGTAACAGCACACGCCTTTGTAATAATCTTTTTTATGGTAATACCCATTATGATTGGGGGCTTTGGGAACTGACTTATTCCCCTAATAATTGGCGCTCCAGACATAGCATTCCCCCGAATAAATAATATAAGCTTTTGACTACTCCCCCCTTCCTTTCTCTTACTCCTTTCTTCTTCGGCTGTAGAAGCGGGGGCCGGGACAGGATGGACAGTTTATCCTCCCTTAGCTGGAAATTTGGCCCATGCAGGAGCATCCGTCGACCTAACCATTTTCTCCCTTCACCTGGCAGGTATTTCTTCAATCCTAGGGGCTATTAATTTTATTACCACTATTATTAACATGAAACCAGCGGCGACTTCAATGTACCAAATTCCTCTGTTCGTTTGGGCTGTACTAATCACTGCCGTTCTCCTTCTCCTTTCACTCCCTGTCTTAGCTGCTGGTATTACAATGCTCTTGACAGATCGAAATCTAAACACCGCCTTCTTTGACCCAGCAGGAGGAGGAGACCCCATTCTGTACCAGCACTTATTC
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Sphyraena jello
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 9
Species With Barcodes: 1
Public Records: 7
Specimens with Barcodes: 9
Species With Barcodes: 1
Trusted
Genomic DNA is available from 1 specimen with morphological vouchers housed at Ocean Genome Legacy
Trusted
Conservation
Threats
Not Evaluated
-
IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
http://www.fishbase.org/references/FBRefSummary.php?id=57073
Trusted
Relevance to Humans and Ecosystems
Benefits
Importance
fisheries: commercial; gamefish: yes
-
International Game Fish Association 1991 World record game fishes. International Game Fish Association, Florida, USA. (Ref. 4699)
http://www.fishbase.org/references/FBRefSummary.php?id=4699&speccode=2590
-
Rose, J.H. 1984 Sphyraenidae. In W. Fischer and G. Bianchi (eds.) FAO species identification sheets for fishery purposes. Western Indian Ocean (Fishing Area 51). Vol. 4. FAO, Rome. pag. var. (Ref. 4752)
http://www.fishbase.org/references/FBRefSummary.php?id=4752&speccode=1235
Trusted
Wikipedia
Pickhandle barracuda
The pickhandle barracuda (Sphyraena jello) is so called because the dark marks along its sides look like the thick ends of pickaxe handles.
Sea anglers sometimes colloquially shorten the name to "pick".
References
- "Sphyraena jello". Integrated Taxonomic Information System. http://www.itis.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=170433. Retrieved 18 April 2006.
- Froese, Rainer, and Daniel Pauly, eds. (2005). "Sphyraena jello" in FishBase. November 2005 version.
Unreviewed
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!



