Overview

Brief Summary

Siamese fighting fish, Betta splendens, are small (about 7.5 cm long) fish in the gourami family (Osphronemidae) native to slow moving and stagnant, overgrown waters in Thailand, Viet Nam, Cambodia and Laos. Characteristic of the suborder Anabantoidei to which they belong, Betta splendens have an accessory breathing organ called the labyrinth organ that allows them to survive in waters with low oxygen content, by breathing air from the surface. These fish have been introduced to Brazil, Columbia, Indonesian and Malaysia, Singapore, the Philippines, Canada, the Dominican Republic and the USA and populations are thought to be established in many of these places. Now one of the most common species in the world-wide aquarium trade, domestication of Betta splendens began in Thailand in the 1800s, where these aggressively territorial fish were bred for competitive fighting. When agitated, wild Siamese fighting fish turn bright colors, and over years of captivity, strains have been bred to take on these colors permanently, as well as varieties with different fin and scale morphologies. In the wild, B. splendens are omnivores, and eat frequently, generally from the surface of the water, such as insects that have fallen in. They also eat algae. Like many gouramis, Siamese fighting fish are bubble breeders, and the males build bubble nests at the surface of the water. After intense courtship displays, the male wraps himself around the female in a nuptial embrace during which he fertilizes eggs released by the female. He then gathers up the eggs in his mouth as they sink and blows them into the nest. This nuptial egg release repeats until the female has no more eggs. The male then tends the eggs until they hatch about 36 hours later. Siamese fighting fish can survive periods in the dry season when water is scarce by aestivating in moist mud.

(Froese Pauly 2010. Betta splendens in FishBase. Retrieved March 6, 2012 from Froese Pauly 2010; Sturgeon 2001; Wikipedia 2012)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: Dana Campbell

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Comprehensive Description

Biology

Occur in standing waters of floodplains, canals, rice paddies (Ref. 12693) and medium to large rivers (Ref. 12975). Feed on zooplankton, mosquito and other insect larvae (Ref. 12693). Air breather and bubble nest builder. Used in behavioral studies (Ref. 4537). Males will fight each other. The many colorful varieties are popular aquarium fish, however, the holding of the males in very small containers should be discouraged (Ref. 1672). Aquarium keeping: sexes should be kept separate unless for mating, and that only one female should be brought into the breeding tank measuring about 20-30 L (http://www.kampffischnet.de).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Biology

Occur in standing waters of floodplains, canals, rice paddies (Ref. 12693) and medium to large rivers (Ref. 12975). Feeds on zooplankton, mosquito and other insect larvae (Ref. 12693). Air breather and bubble nest builder. Used in behavioral studies (Ref. 4537). Males will fight each other. The many colorful varieties are popular aquarium fish, however, the holding of the males in very small containers should be discouraged (Ref. 1672). Aquarium keeping: several females for one male; minimum aquarium size 60 cm (Ref. 51539).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Distribution

Range Description

Endemic to Thailand, from the Mae Khlong to Chao Phraya basins, the eastern slope of the Cardamom mountains, and from the Isthmus of Kra.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The wild Siamese Fighting fish can be found swimming amongst the inland waters of the Orient. It is native to Thailand, but can be found worldwide in pet stores as a domesticated fish. (Hargrove 1999)

Biogeographic Regions: oriental (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Asia: Mekong basin.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Thailand.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

The Betta, on average, is 7.5 centimeters in length. Its body shape is streamlined, allowing it to slip smoothly and effortlessly through open water. The fish's body is covered with scales that overlap each other like the shingles on the roof of a house. These scales consist of thin, transparent plates that help protect the Betta's body from injury and add streamlining for efficient gliding. A mucus layer also covers the scales to provide the fish with extra smoothness and to protect against invading parasites and infection. The Betta's scales grow out from the skin and are generally lacking in color. The fish's true color actually comes from pigment cells (chromatophores) located in the skin itself.

In the wild, the fish uses its coloration to ward off predators and to attract mates. Wild Bettas do not possess the vibrant bright red, lime green, and royal blue colors of their selectively bred counterparts. In fact, they are unusually dull and drab. However, captive-bred Betta males have adopted these new colors and use them to their advantage in mating displays.

The actual colors of a Betta are layered. In order to produce a Betta of specific color, other colors that are layered on top must first be "stripped away" through selective breeding. The top color is blue; next is red, then black and finally yellow.

Bettas have mouths that are upturned, indicating that they are a top feeder and will scoop up their food on the water's surface. Their fins are used not only for propulsion through the water, but for maintaining balance and turning in different directions. They have one caudal fin, one dorsal fin, two pelvic fins, one anal fin, and two pectoral fins. (Hargrove 1999)

Other Physical Features: bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dorsal spines (total): 1; Vertebrae: 29 - 34
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 50 mm ---
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

6.5 cm TL (male/unsexed; (Ref. 12693)); max. reported age: 2 years (Ref. 12193)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Reddish bars on opercle (Ref. 12693).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Inhabits intact marshlands in shallow zones, adaptive to paddyfields.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Betta splendens live in thickly overgrown ponds and in only very slowly flowing waters such as shallow rice paddies, stagnant pools, polluted streams, and other types of areas in which the water has a low-oxygen content. (Hargrove 1999)

Aquatic Biomes: lakes and ponds; rivers and streams

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

benthopelagic; freshwater; pH range: 6.0 - 8.0; dH range: 5 - 19
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Wild Betta splendens feed mainly on insects that have fallen into the water. Because of their rapid metabolic rate, Bettas need to eat frequent, small "snacks", such as algae, to hold them over until their next big meal. (Hargrove 1999) Five different feeding methods have been observed in the Betta: snapping, scooping/gulping, grazing, jumping, and spitting. Snapping is the method most commonly used to "capture" their morsels of food. (Vierke 1988)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Diseases and Parasites

White spot Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Velvet Disease 2 (Piscinoodinium sp.). Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Fish tuberculosis (FishMB). Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Fin-rot Disease (late stage). Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Fin Rot (early stage). Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Edwardsiellosis. Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Columnaris Disease (e.). Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Bacterial Infections (general). Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Builds bubble-nest which is guarded by male.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Average lifespan

Status: captivity:
2 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 2 years Observations: Reproductive senescence has been documented in these animals (Patnaik et al. 1994).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Mating begins with the male Betta building a nest of bubbles. To build this nest, the male swims to the surface, takes a gulp of air and spits out a mucus-coated air bubble. He then quickly takes another bubble of air and releases it near the first one. This process continues for hours with occasional breaks for food or to court the female. After awhile, the nest begins to take on a definate shape. However, the shape and size varies.

Once the nest is nearly complete, an extremely intense and often rough courtship begins. The male very aggressively pursues the female, attempting to entice her under the nest. In his efforts to bring her to the nest, he can be quite brutal if she doesn't willingly respond. More often than not, by the time the first spawning embrace begins, the female's fins are badly torn and she may even be missing some scales.

After spawning has occured, the male then guards the nest, taking care of the eggs until the young hatch 24 to 48 hours later, depending upon the temperature of the water. The young Bettas don't begin to show very much color or fin shape until they are about three months old. At about this time, males begin to fight with one another. It is also quite easy to sex Bettas around this age, as the males are usually more brightly colored and have longer fins than the females. The fish reaches sexual maturity around five months. (Ostrow 1989)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Fins used to communicate: fish
 

Fins of some fish send a warning signal to fellow fish or synchronize movements by vibrating.

       
  "Some fishes use their sense of distant touch not just to navigate but also to communicate, vibrating their fins in specific ways to warn others of their species of danger. The male of the Siamese fighting fish (Betta splendens), which cares for the young, alerts its offspring to danger by vibrating its long, flowing fins. Other fishes use their powers of distant touch to synchronize their movements when swimming together in schools." (Shuker 2001:35-36)
  Learn more about this functional adaptation.
  • Shuker, KPN. 2001. The Hidden Powers of Animals: Uncovering the Secrets of Nature. London: Marshall Editions Ltd. 240 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Betta splendens

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 202 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATTTAATTTTTGGTGCATGAGCCGGAATAGTTGGCACTGCTCTAAGTTTGCTTATTCGGGCAGAACTAAGCCAGCCAGGATCTCTTCTAGGGAATGATCAGATTTATAATGTAATTGTTACGGCACACGCTTTTGTAATAATTTTTTTTATGGTAATGCCTATAATAATTGGAGGTTTTGGGAATTGACTTATTCCCCTAATGATTGGAGCCCCAGACATAGCCTTTCCCCGTATAAATAATATAAGTTTTTGACTTCTCCCTCCCTCCTTCTTGCTTTTACTTACATCTGCCGGTGTAGAGGCTGGGGCAGGTACCGGGTGAACTGTGTATCCCCCCCTATCTGGTAACTTGGCACACACAGGTGCATCGGTGGATTTAACAATTTTTTCACTACACTTAGCAGGTGTCTCATCTATTTTAGGTGCTATTAACTTTATCACTACAATTTTTAATATAAAACCCCCTGCGATAACCCAATACCAAATACCTTTGTTTGTATGATCCGTTTTAATTACTGCTTTCCTCCTCCTTTTATCTCTCCCTGTCTTAGCCGCAGGAATTACAATACTCCTAACAGATCGAAACCTAAACACAACTTTCTTTGATCCAGCAGGCGGAGGAGATCCAATTCTATATCAACACTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Betta splendens

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 101
Specimens with Barcodes: 108
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2ace

Version
3.1

Year Assessed
2013

Assessor/s
Vidthayanon, C.

Reviewer/s
Rainboth, W., Ng, H.H. & Allen, D.

Contributor/s

Justification
This species is threatened by habitat degradation. Habitats across most of its range have been converted into intensive farmland, developed, or polluted, especially in central Thailand which is its centre of population. Genetic erosion from escaped farmed stock into wild habitats is a secondary threat.

Currently its exact extent of occurrence and area of occupancy are poorly known, but is locally uncommon in its suitable habitats. The species is assessed as Vulnerable due to a suspected population decline of at least 30% across its range, and a declining area and extent of occurrence.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The Betta is not endangered.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Locally uncommon throughout its range, suffered much decline due to habitat degradation and pollution.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Habitat degradation is the main threat to the species, and most of its suitable lowland habitat has been converted into intensive farmland and urban areas, or polluted, especially in central Thailand. Genetic erosion is a secondary threat from escaped farmed stock into wild habitats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Vulnerable (VU) (A2ace)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Pet Industry

Betta fish are the victims of an enormous and sometimes harmful industry in which humans capture and breed the fish for ornamental value. As pets, betta fish are often mistreated by receiving little care, poor habitat quality, overfeeding, and a general lack of knowledge by the pet owner.

While betta fish are solitary creatures, they do need to be paid attention to. They need stimulation, which allows them to expand their gills as a sign of dominance, for proper respiration and exercise. This is often not attended to in the pet industry.

While the pet industry has many bettas, the bettas in the wild Thai paddies are decreasing in number due to direct and environmental issues (caused by humans).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: graturbayne

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Captive breeding from wild populations is strongly recommended. Management of known habitats is also needed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Bettas are kept as pets for the enjoyment of humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Importance

fisheries: of no interest; aquarium: highly commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Siamese fighting fish

This article is about the species of fish. For the Danish alternative rock band, see Siamese Fighting Fish (band).

The Siamese fighting fish, also sometimes colloquially known as the betta (Betta splendens), is a species in the gourami family which is popular as an aquarium fish. They are called pla-kad (biting fish) in Thai or trey krem in Khmer. They tend to be rather aggressive.

This species is native to the Mekong basin of Laos, Cambodia, Vietnam, and Thailand, the latter formerly known as Siam. The fish can be found in standing waters of canals, rice paddies, and floodplains.[1]

In January 2014 a large population of the fish was discovered in the Adelaide River Floodplain in the Northern Territory, Australia.[2] As an invasive species they pose a threat to native fish, frogs and other wildlife in the wetlands.[2]

Description[edit]

B. splendens usually grows to a length of about 6.5 cm (2.6 in).[1] Although aquarium specimens are known for their brilliant colors and large, flowing fins, the natural coloration of B. splendens is a dull green, browns, and gray, and the fins of wild specimens are relatively short.

Diet[edit]

Betta splendens feeds on zooplankton, crustaceans, and the larvae of mosquitoes and other water-bound insects.[3]

Reproduction and early development[edit]

A pair spawning under a bubble nest in a breeder's tank
One-day-old larvae in a bubble nest, their yolk sacs have not yet been absorbed: Betta fry rely entirely on their gills to breathe.
Betta splendens fish build bubble nests of varying sizes.
A 15-day-old, free-swimming fry is infected with Piscinoodinium sp. (velvet disease), a common killer of betta fry in captivity.

Male bettas flare their gills, twist their bodies, and spread their fins if interested in a female. The female darkens in colour, then curves her body back and forth as a response. Males build bubble nests of various sizes and thicknesses at the surface of the water. They do this regularly even if there is no female present. Plants or rocks that break the surface often form a base for bubble nests. The act of spawning itself is called a "nuptial embrace", for the male wraps his body around the female; around 10–40 eggs are released during each embrace, until the female is exhausted of eggs. The male, in his turn, releases milt into the water, and fertilization takes place externally. During and after spawning, the male uses his mouth to retrieve sinking eggs and deposit them in the bubble nest (during mating the female sometimes assists her partner, but more often she simply devours all the eggs she manages to catch). Once the female has released all of her eggs, she is chased away from the male's territory, as she will likely eat the eggs.[4] The eggs remain in the male's care. He carefully keeps them in his bubble nest, making sure none falls to the bottom, repairing the bubble nest as needed. Incubation lasts for 24–36 hours; newly hatched larvae remain in the nest for the next two to three days until their yolk sacs are fully absorbed. Afterwards, the fry leave the nest and the free-swimming stage begins. In this first period of their lives, B. splendens fry are totally dependent on their gills; the labyrinth organ which allows the species to breathe atmospheric oxygen typically develops at three to six weeks of age, depending on the general growth rate, which can be highly variable. B. splendens can reach sexual maturity at an age as early as 4–5 months.

History[edit]

Some people of Thailand and Malaysia are known to have collected these fish prior to the 19th century from the wild.

In the wild, bettas spar for only a few minutes or before one fish backs off. Bred specifically for fighting, domesticated betta matches can go on for much longer, with winners determined by a willingness to continue fighting. Once one fish retreats, the match is over.

Seeing the popularity of these fights, the king of Thailand started licensing and collecting these fighting fish. In 1840, he gave some of his prized fish to a man who, in turn, gave them to Dr. Theodor Cantor, a medical scientist. Nine years later, Dr. Cantor wrote an article describing them under the name Macropodus pugnax. In 1909, the ichthyologist Charles Tate Regan, realizing a species was already named Macropodus pugnax, renamed the domesticated Siamese fighting fish Betta splendens.[5]

1892 this species was imported to France, and 1896 the famous aquarium fish importer Paul Matte in Berlin, imported the first specimens to Germany from Moscow.[6]

In the aquarium[edit]

Betta species prefer a water of around 23ºC-27ºC but have been seen to survive at the extremes of 20ºC-30ºC though their life quality may be diminished at these extremes of the betta's tolerance.[citation needed] They have an organ known as the labyrinth organ which allows them to breathe air at the water's surface. This organ was thought to allow the fish to be kept in unmaintained aquaria,[7] but this is a misconception, as poor water quality makes all tropical fish, including Betta splendens, more susceptible to diseases such as fin rot.

Properly kept and fed a correct diet, Siamese fighting fish live about seven years in captivity, and up to 10 years in rare cases.[citation needed]

Varieties[edit]

B. splendens can be hybridized with B. imbellis, B. mahachaiensis, and B. smaragdina, though with the latter, the fry tend to have low survival rates. In addition to these hybrids within the Betta genus, intergeneric hybridizing of Betta splendens and Macropodus opercularis, the paradise fish, has been reported. A fairly recent variety to hit the markets is the king betta, a variety of largely unknown provenance which may or may not be derived from crossing B. splendens with B. raja.[8]

Breeders around the world continue to develop new varieties. Often, the males of the species are sold preferentially in stores because of their beauty, compared to the females. Recently, breeders have developed in females the same range of colors previously only bred in males.[citation needed] Females almost never develop fins as showy as males of the same type and are often more subdued in coloration, though some breeders manage to get females with fairly long fins and bright colors. .

Colors[edit]

A dalmatian orange male

Wild fish exhibit strong colors only when agitated.[citation needed] Breeders have been able to make this coloration permanent, and a wide variety of hues breed true. Colors available to the aquarist include red, orange, yellow, blue, steel blue, turquoise/green, black, pastel, white ("opaque" white, not to be confused with albino), and multi-colored fish. The shades of blue, turquoise, and green are slightly iridescent, and can appear to change color with different lighting conditions or viewing angles; this is because these colors (unlike black or red) are not due to pigments, but created through refraction within a layer of translucent guanine crystals. Breeders have also developed different color patterns such as marble and butterfly, as well as metallic shades through hybridization[9] like copper, gold, or platinum (these were obtained by crossing B. splendens to other Betta species).

Purple and blue female

A true albino betta has been feverishly sought since one recorded appearance in 1927, and another in 1953 .[citation needed] Neither of these was able to establish a line of true albinos. In 1994, a hobbyist named Kenjiro Tanaka claimed to have successfully bred albino bettas.[10]

Some bettas will change colors throughout their lifetime (known as marbling), attributed to a transposon.[11]

Finnage variations[edit]

A metallic, double-tail male
A crowntail male

Breeders have developed several different finnage and scale variations:

  • Veil tail (extended finnage length and non-symmetrical tail; caudal fin rays usually only split once) the most common tail type seen in pet stores.
  • Crown tail (fin rays are extended well beyond the membrane and consequently the tail can take on the appearance of a crown; also called fringetail)
  • Comb tail (less extended version of the crown tail, derived from breeding crown and another finnage type)
  • Half-moon ("D" shaped caudal fin that forms a 180° angle, the edges of the tail are crisp and straight)
  • Over-half-moon (caudal fin is in excess of the 180° angle, byproduct of trying to breed half-moons, can sometimes cause problems because the fins are too big for the fish to swim properly)
  • Rose tail (halfmoon variation with so much finnage that it overlaps and looks like a rose)
  • Feather tail (similar to the rose tail, with a rougher appearance)
  • Short-finned fighting style (sometimes called "plakat")
  • Half-moon plakat (short-finned half-moon, plakat and half-moon cross)
  • Double tail (the tail fin is duplicated into two lobes and the dorsal fin is significantly elongated, the two tails can show different levels of bifurcation depending on the individual)
  • Delta tail (tail spread less than that of a half-moon with sharp edges)
  • Half-sun (combtail with caudal fin going 180°, like a half-moon)
  • Elephant ear (pectoral fins are white, and much larger than normal, resembling the ears of an elephant)
  • Spade tail (caudal fin has a wide base that narrows to a small point)

Behavior[edit]

A male attacking and flaring at his reflection in a mirror.

Males and females flare or puff out their gill covers (opercula) to appear more impressive, either to intimidate other rivals or as an act of courtship. Other reasons for flaring is when they are startled by movement or change of scene in their environments. Both sexes display horizontal bars (unless they are too light a color for this to show) if stressed or frightened; however, such a color change, common in females of any age, is very rare in mature males. Females often flare at other females, especially when setting up a pecking order. Flirting fish behave similarly, with vertical instead of horizontal stripes indicating a willingness and readiness to breed (females only). In fact, the fish flare their fins and gill covers as a sign of aggression or flirting with other fish. Bettas sometimes require a place to hide, even in the absence of threats. They may set up a territory centered on a plant or rocky alcove, sometimes becoming highly possessive of it and aggressive toward trespassing rivals.

The aggression of this fish has been studied by ethologists and comparative psychologists.[12] These fish have historically been the objects of gambling; two male fish are pitted against each other in a fight and bets are placed on which one will win. One fish is almost always killed as a result. To avoid this, male Siamese fighting fish are best isolated from one another. Males will occasionally even respond aggressively to their own reflections in a mirror. Though this is obviously safer than exposing the fish to another male, prolonged sight of their reflection can lead to stress in some individuals. Not all Siamese fighting fish respond negatively to other male fish, especially if not too many of them are present.[citation needed]

Several females in a community tank with mollies and rainbowfish

Name[edit]

Although commonly called a betta in the aquarium trade, especially in North America, that is the name of a genus not only containing this fish, but also other species. B. splendens is more accurately called by its scientific name or "Siamese fighting fish", to avoid confusion with the other species in the genus.

In popular culture[edit]

  • In the 1963 James Bond movie From Russia with Love, the strategy of the criminal organization SPECTRE is compared to three Siamese fighting fish in the same tank: Two will fight each other to the death while the third will wait its turn to fight the exhausted victor, symbolizing the conflict between the USA and the Soviet Union, with SPECTRE as the fish that waits.
  • The title of S.E. Hinton's 1975 novel, Rumble Fish, is an eponymous reference to what two brothers call the breed. In Francis Ford Coppola's 1983 film adaptation, everything appears in black and white except the Siamese fighting fish.
  • A 2006 episode of Cold Case ("Saving Sammy") features a boy with a pet Siamese fighting fish.
  • The Siamese fighting fish has been used as the default background in the beta and release candidate versions of the 2009 Windows 7 operating system, in an apparent reference to the name "Betta". A similar wallpaper and boot screen also was used in the prereleases of Windows 8.
  • A Siamese fighting fish features as a clue in a murder in the 2009 film Bad Lieutenant: Port of Call New Orleans.
  • Milo, one of the main characters in the Disney Channel's 2010 series, Fish Hooks, is a Siamese fighting fish.
  • In the BBC children's series M.I. High, the plot of one episode involves causing the children to have their minds altered to that of a fighting fish by use of brainwaves distributed in a Van de Graaff generator.
  • In a season 4 episode of FX's animated series "Archer" ("Live And Let Dine") character Pam Poovey is shown to have a pet Siamese fighting fish named Germaine. Although she is quite attached to him, he is proven to be very poor at his job, (illegal fish fighting) having driven Pam $14,000 into debt.
  • A Siamese fighting fish named Juice Lee is featured in "To the Rescue (Part 2)", an episode of Chip 'n Dale Rescue Rangers.

References[edit]

  1. ^ a b Froese, Rainer and Pauly, Daniel, eds. (2014). "Betta splendens" in FishBase. February 2014 version.
  2. ^ a b Bray, Dianne. "Siamese Fighting Fish, Betta splendens". Fishes of Australia. Retrieved 29 September 2014. 
  3. ^ "betta food". Bettatalk.com. Retrieved 2012-08-01. 
  4. ^ Leong, Paul (2004). Tips on Spawning Bubblenesting Bettas. Retrieved on March 13, 2009.
  5. ^ "Betta Origins". Betta Fish Center. Retrieved 11 June 2011. 
  6. ^ "Betta splendens -article-". kcff.net. 
  7. ^ Caller, Steven. "Betta Fish Introduction". My Betta Fish. Retrieved 2012-08-01. 
  8. ^ Juniper Russo (2009): "King Betta" Variety Sold at Petco
  9. ^ "Metallics and Masked". Betty
    Splendens.
    com
    .
     
  10. ^ "Albino image". Retrieved 2012-08-01. 
  11. ^ http://www.ibcbettas.org/2012/wp-content/uploads/2012/11/IBC%20TA%20Articles/CS-02.pdf
  12. ^ Bronstein, Paul M. (1998). "Agonistic Sequences and the Assessment of Opponents in Male Betta splendens". American Journal of Psychology 265 (2): 163–177. JSTOR 1422809. 

Further reading[edit]

  • Simpson, M. J. A. (1968). "The display of the Siamese fighting fish Betta splendens". Animal Behaviour Monographs 1: 1–73. 
  • Thompson, T (1966). "Operant and Classically-Conditioned Aggressive Behavior in Siamese Fighting Fish". American Zoologist 6: 629–741. doi:10.1093/icb/6.4.629. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!