Overview

Comprehensive Description

Biology

Occurs in outer lagoon and seaward reefs, usually seen in small groups and school in some oceanic locations (Ref. 48637). Benthopelagic (Ref. 58302). Feeds primarily on the algal film covering compacted sand, ingesting the usual component of sand which probably aids in the trituration of the algal food in the thick-walled stomach, also feeds on diatoms and detritus (Ref. 3921).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-Pacific: East Africa, including the Mascarene Islands (Ref. 37792) to the Hawaiian and Society islands, north to Ryukyu Islands, south to Lord Howe Island.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mozambique, Reunion, Somalia, South Africa (country)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific: East Africa and South Africa, Aldabra, Madagascar and Mascarenes east to Hawaiian Islands and Society Islands, north to Ryukyu Islands and Ogasawara Islands, south to Lord Howe Island and New Caledonia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 25 - 27; Analspines: 3; Analsoft rays: 24 - 25
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 420 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

45.0 cm SL (male/unsexed; (Ref. 48637))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Color in life bluish grey with numerous yellowish brown spots which tend to form irregular longitudinal lines; head with narrow irregular stripes; behind eye a yellow spot; brown pectoral fins; base of caudal fin with white bar. Caudal spine large, 3 - 4.4 in head. Stomach gizzard-like. Differs from A. dussumieri by having vertical stripes instead of spots on the blue central area of the caudal fin, from A. mata by having a lunate caudal fin, and from A. xanthopterus by having plain brown to blue-grey pectoral fins (Ref. 1602). The white ring around the base of the tail varies in intensity and may occasionally be absent (Ref. 1602).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Occurs in outer lagoon and seaward reefs to a depth of over 12 m and feeds primarily on the algal film covering compacted sand.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 1 - 12 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 5 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 1 - 39
  Temperature range (°C): 25.709 - 28.749
  Nitrate (umol/L): 0.052 - 0.678
  Salinity (PPS): 32.279 - 35.312
  Oxygen (ml/l): 4.484 - 4.727
  Phosphate (umol/l): 0.141 - 0.327
  Silicate (umol/l): 1.409 - 4.452

Graphical representation

Depth range (m): 1 - 39

Temperature range (°C): 25.709 - 28.749

Nitrate (umol/L): 0.052 - 0.678

Salinity (PPS): 32.279 - 35.312

Oxygen (ml/l): 4.484 - 4.727

Phosphate (umol/l): 0.141 - 0.327

Silicate (umol/l): 1.409 - 4.452
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 1 - 12m.
From 1 to 12 meters.

Habitat: reef-associated. Occurs in outer lagoon and seaward reefs. Feeds primarily on the algal film covering compacted sand, ingesting the usual component of sand which probably aids in the trituration of the algal food in the thick-walled stomach, Also feeds on diatoms and detritus (Ref. 3921).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Acanthurus blochii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ACCCTTTATTTAGTATTTGGTGCTTGAGCTGGGATAGTAGGAACGGCTCTAAGCCTTCTAATCCGAGCAGAATTAAGCCAACCAGGCGCCCTCCTAGGGGATGACCAGATTTATAATGTAATTGTTACAGCACACGCGTTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGTGGGTTTGGAAACTGATTAATTCCACTAATGATTGGAGCTCCTGATATAGCATTCCCACGAATGAATAATATGAGTTTTTGACTACTACCACCATCTTTTCTACTCTTACTCGCATCCTCTGCAGTAGAATCCGGCGCCGGTACAGGATGGACAGTTTATCCTCCTCTAGCTGGTAACCTTGCACATGCAGGAGCATCCGTAGACCTGACTATTTTCTCCCTCCACCTCGCAGGAATTTCCTCAATTCTTGGGGCTATTAACTTTATCACAACGATTATTAATATAAAACCTCCTGCTACTTCTCAGTATCAAACTCCCTTATTTGTATGAGCAGTATTAATTACTGCCGTCCTACTACTCCTCTCACTTCCTGTTCTTGCTGCTGGTATTACAATACTACTCACAGACCGAAATTTAAATACCACTTTCTTTGATCCGGCAGGCGGAGGGGACCCCATNCTATATCNACANNNN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Acanthurus blochii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Acanthurus blochii

The Ringtail surgeonfish (Acanthurus blochii) is a marine reef tang in the fish family Acanthuridae. The fish grow to a maximum length of 45 cm (18 in).

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!