Overview
Comprehensive Description
Biology
Occurs in outer lagoon and seaward reefs, usually seen in small groups and school in some oceanic locations (Ref. 48637). Benthopelagic (Ref. 58302). Feeds primarily on the algal film covering compacted sand, ingesting the usual component of sand which probably aids in the trituration of the algal food in the thick-walled stomach, also feeds on diatoms and detritus (Ref. 3921).
-
Randall, J.E. 1987 Three nomenclatorial changes in Indo-Pacific surgeonfishes (Acanthurinae). Pac. Sci. 41(1-4):54-61. (Ref. 1921)
http://www.fishbase.org/references/FBRefSummary.php?id=1921&speccode=4750
Trusted
Distribution
Indo-Pacific: East Africa, including the Mascarene Islands (Ref. 37792) to the Hawaiian and Society islands, north to Ryukyu Islands, south to Lord Howe Island.
-
Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
http://www.fishbase.org/references/FBRefSummary.php?id=1602&speccode=4306
Trusted
Mozambique, Reunion, Somalia, South Africa (country)
-
Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5909
-
Anon. (2000). FishBase 2000 [CD-ROM]. ICLARM: Los Baños, Laguna, Philippines. 4 cd-roms pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6542
-
Letourneur, Y., M. Harmelin-Vivien & R. Galzin (1993). Impact of hurricane Firinga on fish community structure on fringing reefs of Reunion Island, S.W. Indian Ocean. Environmental Biology of Fishes 37: 109-120
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6048
Trusted
Indo-West Pacific: East Africa and South Africa, Aldabra, Madagascar and Mascarenes east to Hawaiian Islands and Society Islands, north to Ryukyu Islands and Ogasawara Islands, south to Lord Howe Island and New Caledonia.
Trusted
Physical Description
Morphology
Dorsal spines (total): 9; Dorsal soft rays (total): 25 - 27; Analspines: 3; Analsoft rays: 24 - 25
-
Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334)
http://www.fishbase.org/references/FBRefSummary.php?id=2334&speccode=13770
Trusted
Size
Max. size
45.0 cm SL (male/unsexed; (Ref. 48637))
-
Kuiter, R.H. and T. Tonozuka 2001 Pictorial guide to Indonesian reef fishes. Part 3. Jawfishes - Sunfishes, Opistognathidae - Molidae. Zoonetics, Australia. p. 623-893. (Ref. 48637)
http://www.fishbase.org/references/FBRefSummary.php?id=48637&speccode=4748
Trusted
Diagnostic Description
Color in life bluish grey with numerous yellowish brown spots which tend to form irregular longitudinal lines; head with narrow irregular stripes; behind eye a yellow spot; brown pectoral fins; base of caudal fin with white bar. Caudal spine large, 3 - 4.4 in head. Stomach gizzard-like. Differs from A. dussumieri by having vertical stripes instead of spots on the blue central area of the caudal fin, from A. mata by having a lunate caudal fin, and from A. xanthopterus by having plain brown to blue-grey pectoral fins (Ref. 1602). The white ring around the base of the tail varies in intensity and may occasionally be absent (Ref. 1602).
-
Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334)
http://www.fishbase.org/references/FBRefSummary.php?id=2334&speccode=13770
Trusted
Description
Occurs in outer lagoon and seaward reefs to a depth of over 12 m and feeds primarily on the algal film covering compacted sand.
-
Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5909
Trusted
Ecology
Habitat
Environment
reef-associated; marine; depth range 1 - 12 m (Ref. 9710)
-
Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
http://www.fishbase.org/references/FBRefSummary.php?id=9710&speccode=13770
Trusted
Depth range based on 5 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.
Environmental ranges
Depth range (m): 1 - 39
Temperature range (°C): 25.709 - 28.749
Nitrate (umol/L): 0.052 - 0.678
Salinity (PPS): 32.279 - 35.312
Oxygen (ml/l): 4.484 - 4.727
Phosphate (umol/l): 0.141 - 0.327
Silicate (umol/l): 1.409 - 4.452
Graphical representation
Depth range (m): 1 - 39
Temperature range (°C): 25.709 - 28.749
Nitrate (umol/L): 0.052 - 0.678
Salinity (PPS): 32.279 - 35.312
Oxygen (ml/l): 4.484 - 4.727
Phosphate (umol/l): 0.141 - 0.327
Silicate (umol/l): 1.409 - 4.452
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 4 samples.
Environmental ranges
Depth range (m): 1 - 39
Temperature range (°C): 25.709 - 28.749
Nitrate (umol/L): 0.052 - 0.678
Salinity (PPS): 32.279 - 35.312
Oxygen (ml/l): 4.484 - 4.727
Phosphate (umol/l): 0.141 - 0.327
Silicate (umol/l): 1.409 - 4.452
Graphical representation
Depth range (m): 1 - 39
Temperature range (°C): 25.709 - 28.749
Nitrate (umol/L): 0.052 - 0.678
Salinity (PPS): 32.279 - 35.312
Oxygen (ml/l): 4.484 - 4.727
Phosphate (umol/l): 0.141 - 0.327
Silicate (umol/l): 1.409 - 4.452
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Depth: 1 - 12m.
From 1 to 12 meters.
Habitat: reef-associated. Occurs in outer lagoon and seaward reefs. Feeds primarily on the algal film covering compacted sand, ingesting the usual component of sand which probably aids in the trituration of the algal food in the thick-walled stomach, Also feeds on diatoms and detritus (Ref. 3921).
From 1 to 12 meters.
Habitat: reef-associated. Occurs in outer lagoon and seaward reefs. Feeds primarily on the algal film covering compacted sand, ingesting the usual component of sand which probably aids in the trituration of the algal food in the thick-walled stomach, Also feeds on diatoms and detritus (Ref. 3921).
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Acanthurus blochii
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
Download FASTA File
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
ACCCTTTATTTAGTATTTGGTGCTTGAGCTGGGATAGTAGGAACGGCTCTAAGCCTTCTAATCCGAGCAGAATTAAGCCAACCAGGCGCCCTCCTAGGGGATGACCAGATTTATAATGTAATTGTTACAGCACACGCGTTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGTGGGTTTGGAAACTGATTAATTCCACTAATGATTGGAGCTCCTGATATAGCATTCCCACGAATGAATAATATGAGTTTTTGACTACTACCACCATCTTTTCTACTCTTACTCGCATCCTCTGCAGTAGAATCCGGCGCCGGTACAGGATGGACAGTTTATCCTCCTCTAGCTGGTAACCTTGCACATGCAGGAGCATCCGTAGACCTGACTATTTTCTCCCTCCACCTCGCAGGAATTTCCTCAATTCTTGGGGCTATTAACTTTATCACAACGATTATTAATATAAAACCTCCTGCTACTTCTCAGTATCAAACTCCCTTATTTGTATGAGCAGTATTAATTACTGCCGTCCTACTACTCCTCTCACTTCCTGTTCTTGCTGCTGGTATTACAATACTACTCACAGACCGAAATTTAAATACCACTTTCTTTGATCCGGCAGGCGGAGGGGACCCCATNCTATATCNACANNNN
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Acanthurus blochii
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 11
Species With Barcodes: 1
Public Records: 1
Specimens with Barcodes: 11
Species With Barcodes: 1
Trusted
Conservation
Threats
Least Concern (LC)
-
IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
http://www.fishbase.org/references/FBRefSummary.php?id=57073
Trusted
Relevance to Humans and Ecosystems
Benefits
Importance
fisheries: commercial; aquarium: commercial
-
Miyasaka, A. 1993 A database on scientific and common names of fishes exported from Hawaii. The information was derived from the above mentioned database. A printout of the names is also available from the State of Hawaii, Department of Land and Natural Resources, 1151 Punchbowl Street, Honolulu, Hawaii. (Ref. 5358)
http://www.fishbase.org/references/FBRefSummary.php?id=5358&speccode=4306
-
Wantiez, L. 1993 Les poissons des fonds meubles du lagon Nord et de la Baie de Saint-Vincent de Nouvelle-Calédonie: Description des peuplements, structure et fonctionnement des communautés. Ph.D. Thesis, Université d' Aix-Marseille II, France. (Ref. 9070)
http://www.fishbase.org/references/FBRefSummary.php?id=9070&speccode=4534
Trusted
Wikipedia
Acanthurus blochii
The Ringtail surgeonfish (Acanthurus blochii) is a marine reef tang in the fish family Acanthuridae. The fish grow to a maximum length of 45 cm (18 in).
References
- Froese, Rainer, and Daniel Pauly, eds. (2005). Acanthurus blochii in FishBase. May 2005 version.
Unreviewed
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!



