Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Adults occur in outer lagoon and seaward reefs, usually seen in small groups and school in some oceanic locations (Ref. 48637). Benthopelagic (Ref. 58302). They feed primarily on the algal film covering compacted sand, ingesting the usual component of sand which probably aids in the trituration of the algal food in the thick-walled stomach, also feed on diatoms and detritus (Ref. 3921).
  • Randall, J.E. 1987 Three nomenclatorial changes in Indo-Pacific surgeonfishes (Acanthurinae). Pac. Sci. 41(1-4):54-61. (Ref. 1921)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Acanthurus blochii is found from the coast of East Africa to the Hawaiian Islands and the islands of French Polynesia, northwards to the Ryukyu Islands, Japan, southwards to the Great Barrier Reef and Lord Howe Island, Australia (Randall 2001). It is also reported from Rowley Shoals, Scott Reef and Ashmore Reef (Allen and Russell 1986) and Christmas Island (J.H. Choat pers. comm. 2010). Records from the New South Wales coast may be based on misidentification of A. dussumieri (J.H. Choat and B. Russell pers. comm. 2010).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: East Africa, including the Mascarene Islands (Ref. 37792) to the Hawaiian and Society islands, north to Ryukyu Islands, south to Lord Howe Island.
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: East Africa and South Africa, Aldabra, Madagascar and Mascarenes east to Hawaiian Islands and Society Islands, north to Ryukyu Islands and Ogasawara Islands, south to Lord Howe Island and New Caledonia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 25 - 27; Analspines: 3; Analsoft rays: 24 - 25
  • Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Max. size

45.0 cm SL (male/unsexed; (Ref. 48637)); max. reported age: 35 years (Ref. 52229)
  • Kuiter, R.H. and T. Tonozuka 2001 Pictorial guide to Indonesian reef fishes. Part 3. Jawfishes - Sunfishes, Opistognathidae - Molidae. Zoonetics, Australia. p. 623-893. (Ref. 48637)
  • Choat, J.H. and D.R. Robertson 2002 Age-based studies on coral reef fishes. p. 57-80. In P.F. Sale (ed.) Coral reef fishes: dynamics and diversity in a complex ecosystem. Academic Press. (Ref. 52229)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 420 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Occurs in outer lagoon and seaward reefs to a depth of over 12 m and feeds primarily on the algal film covering compacted sand.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Color in life bluish grey with numerous yellowish brown spots which tend to form irregular longitudinal lines; head with narrow irregular stripes; behind eye a yellow spot; brown pectoral fins; base of caudal fin with white bar. Caudal spine large, 3 - 4.4 in head. Stomach gizzard-like. Differs from A. dussumieri by having vertical stripes instead of spots on the blue central area of the caudal fin, from A. mata by having a lunate caudal fin, and from A. xanthopterus by having plain brown to blue-grey pectoral fins (Ref. 1602). The white ring around the base of the tail varies in intensity and may occasionally be absent (Ref. 1602).
  • Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Acanthurus blochii occurs on shallow coral reef (Randall 2001). It is occasionally observed in seagrass beds in Ryukyu Islands (Nakamura amd Tsuchiya 2009). Juveniles settle in coral rubble at Ishigaki Island, Japan (Nakamura et al. 2009). It feeds on detritus and sedimentary material (Choat et al. 2004). It is classified as a grazer/detritivore (J.H. Choat and D.R. Bellwood pers. obs. in Green and Bellwood 2009). Maximum age recorded was 35 years (Choat and Robertson 2002). The sexes are separate among the acanthurids and there is no evidence of sexual dimorphism (Reeson 1983).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 2 - 15 m (Ref. 90102)
  • Allen, G.R. and M.V. Erdmann 2012 Reef fishes of the East Indies. Perth, Australia: Universitiy of Hawai'i Press, Volumes I-III. Tropical Reef Research. (Ref. 90102)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 5 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 1 - 39
  Temperature range (°C): 25.709 - 28.749
  Nitrate (umol/L): 0.052 - 0.678
  Salinity (PPS): 32.279 - 35.312
  Oxygen (ml/l): 4.484 - 4.727
  Phosphate (umol/l): 0.141 - 0.327
  Silicate (umol/l): 1.409 - 4.452

Graphical representation

Depth range (m): 1 - 39

Temperature range (°C): 25.709 - 28.749

Nitrate (umol/L): 0.052 - 0.678

Salinity (PPS): 32.279 - 35.312

Oxygen (ml/l): 4.484 - 4.727

Phosphate (umol/l): 0.141 - 0.327

Silicate (umol/l): 1.409 - 4.452
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 12m.
From 1 to 12 meters.

Habitat: reef-associated. Occurs in outer lagoon and seaward reefs. Feeds primarily on the algal film covering compacted sand, ingesting the usual component of sand which probably aids in the trituration of the algal food in the thick-walled stomach, Also feeds on diatoms and detritus (Ref. 3921).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Acanthurus blochii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ACCCTTTATTTAGTATTTGGTGCTTGAGCTGGGATAGTAGGAACGGCTCTAAGCCTTCTAATCCGAGCAGAATTAAGCCAACCAGGCGCCCTCCTAGGGGATGACCAGATTTATAATGTAATTGTTACAGCACACGCGTTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGTGGGTTTGGAAACTGATTAATTCCACTAATGATTGGAGCTCCTGATATAGCATTCCCACGAATGAATAATATGAGTTTTTGACTACTACCACCATCTTTTCTACTCTTACTCGCATCCTCTGCAGTAGAATCCGGCGCCGGTACAGGATGGACAGTTTATCCTCCTCTAGCTGGTAACCTTGCACATGCAGGAGCATCCGTAGACCTGACTATTTTCTCCCTCCACCTCGCAGGAATTTCCTCAATTCTTGGGGCTATTAACTTTATCACAACGATTATTAATATAAAACCTCCTGCTACTTCTCAGTATCAAACTCCCTTATTTGTATGAGCAGTATTAATTACTGCCGTCCTACTACTCCTCTCACTTCCTGTTCTTGCTGCTGGTATTACAATACTACTCACAGACCGAAATTTAAATACCACTTTCTTTGATCCGGCAGGCGGAGGGGACCCCATNCTATATCNACANNNN
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Acanthurus blochii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
Choat, J.H., Abesamis, R., Clements, K.D., McIlwain, J., Myers, R., Nanola, C., Rocha, L.A., Russell, B. & Stockwell, B.

Reviewer/s
Davidson, L., Edgar, G. & Kulbicki, M.

Contributor/s

Justification
Acanthurus blochii is widespread and common in parts of its range. It is a targeted food fish in parts of its distribution (Guam, Saipan and the Philippines) and is harvested for the aquarium trade. There are localized declines observed in the Philippines but there is no evidence of global population declines due to fishing. It occurs in a number of marine protected areas and is therefore listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Acanthurus blochii was recorded as occasional in terms of relative abundance in Calamianes Islands, Philippines and the northern Bismarck Sea, Papua New Guinea (Werner and Allen 2000, Allen 2009). It was recorded as common in Milne Bay, Papua New Guinea (Allen 2003). It is moderately common at Raja Ampat (Allen 2003b). It is common in the American Samoa National Park (National Park of Samoa Checklist of Fishes, accessed 21 April 2010). It is one of the most common fishes recorded in the Bar Reef Marine Sanctuary (BRMS), northwestern Sri Lanka. It was found to be most abundant in shallow reef flat and structured sandstone reef habitats (Ohman et al. 1997).

Density and biomass did not change significantly in marine reserves censused in New Caledonia before and after protection (Wantiez et al. 1997).

Before After
Density (10-2 fish m-2) 1.26 (0.50) 1.36 (0.39)
Biomass (g m-2) 1.65 (0.33) 2.21 (0.65)

A. blochii accounts for 2% and 1% of the Acanthurid fishery in Guam (Division of Aquatic and Wildlife Resources unpub. data) and Saipan (P. Houk unpub. data) respectively, but shows no signs of decline. It was not observed from the fishery in Ponpei (Rhodes et al. 2008). Average catch is 2,900 kg/year in Hawaii (Division of Aquatic Resources unpub. data). This species is collected as an aquarium fish in West Hawaii. The total number of individuals caught from FY 2005-2009 was 134 with a total value of $182 (Walsh et al. 2010).

In Kenya, landings during 1978-2001 for families that are less important in commercial catches (e.g., scarinae and Acanthuridae) showed rising catches (1978-1984) followed by a general decline during the 1990s, but the landings for the scarinae showed a rising trend in recent years (Kaunda-Arara et al. 2003).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Acanthurus blochii is a targeted food fish in parts of its range. There have been localized declines due to fishing in the Philippines.

Surgeonfishes show varying degrees of habitat preference and utilization of coral reef habitats, with some species spending the majority of their life stages on coral reef while others primarily utilize seagrass beds, mangroves, algal beds, and /or rocky reefs. The majority of surgeonfishes are exclusively found on coral reef habitat, and of these, approximately 80% are experiencing a greater than 30% loss of coral reef area and degradation of coral reef habitat quality across their distributions. However, more research is needed to understand the long-term effects of coral reef habitat loss and degradation on these species' populations. Widespread coral reef loss and declining habitat conditions are particularly worrying for species that recruit into areas with live coral cover, especially as studies have shown that protection of pristine habitats facilitate the persistence of adult populations in species that have spatially separated adult and juvenile habitats (Comeros-Raynal et al. 2012).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for this species. Its distribution overlaps several marine protected areas in parts of its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquarium: commercial
  • Miyasaka, A. 1993 A database on scientific and common names of fishes exported from Hawaii. The information was derived from the above mentioned database. A printout of the names is also available from the State of Hawaii, Department of Land and Natural Resources, 1151 Punchbowl Street, Honolulu, Hawaii. (Ref. 5358)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Acanthurus blochii

The Ringtail surgeonfish (Acanthurus blochii) is a marine reef tang in the fish family Acanthuridae. The fish grow to a maximum length of 45 cm (18 in).

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!