Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Inhabit seaward reefs, in areas of bare rock or mixed rubble and sand, from 9 to at least 46 m depth; juveniles inhabit protected bays and lagoons, singly or in small groups in as little as 3 m (Ref. 1602, 48637). Benthopelagic (Ref. 58302). Adults occur singly or in schools and feed on surface film of detritus, diatoms, and fine filamentous algae covering sand and bare rock (Ref. 1602). Rarely poisonous (Ref. 4795).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Acanthurus olivaceus is found from southern Japan to northern New South Wales, Australia, eastwards to the Hawaiian Islands and Tuamotu Archipelago. In the Indian Ocean, it is found from Christmas Island (Allen and Swainston, 1988), Cocos-Keeling Islands (Allen and Smith-Vaniz 1994), Western Australia to Ningaloo Reef (Allen and Swainston 1988).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Pacific Ocean: Christmas Island and Cocos-Keeling Islands in the eastern Indian Ocean to the Hawaiian and Tuamoto islands, north to Japan, south to Lord Howe Island. Replaced by Acanthurus tennenti in the Indian Ocean (Ref. 37816).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: Christmas and Cocos Keeling Islands east to Hawaiian Islands and Tuamotu Archipelago, north to southern Japan, south to Western Australia, Lord Howe Island, New Caledonia and Tonga.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 23 - 25; Analspines: 3; Analsoft rays: 22 - 24
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 350 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

35.0 cm TL (male/unsexed; (Ref. 2334))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Body of adult dark grayish brown; juveniles yellow; posterior to upper end of gill opening is a bright orange horizontal band, with purplish black border. Head and anterior half of body usually abruptly paler than the posterior half. Anterior gill rakers 24-28; posterior 23-27. Large adult males (about 17 cm) with more definite convexity of snout profile.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Acanthurus olivaceus is usually encountered grazing over sand near reefs, sometimes in small aggregations (Randall 2001a), submarine observations to 62 m (Chave and Mundy 1994). It occurs over coral and rubble bottoms (Brown and Allen 2008). It is found in depths from 9 to at least 46 m depth, juveniles inhabit protected bays and lagoons, singly or in small groups in as little as 3 m. Adults occur singly or in schools. Its diet is dominated by organic detritus and calcareous sediments with very small portions of identifiable algae (Choat et al. 2002).

Reproduction

The sexes are separate among the acanthurids (Reeson 1983). Acanthurids do not display obvious sexual dimorphism, males assume courtship colours (J.H. Choat pers. comm. 2010). This species was reported to form spawning aggregations on the Great Barrier Reef (Squire and Samoilys unpub. data). Size at sexual maturity 180 mm (Choat and Robertson 2002a).

Growth

It shows rapid growth for the first three to four years of life. Beyond four years, growth declines sharply; resulting in extended periods of asymptotic growth. The maximum number of annuli recorded for this species was 32 to 35 (Choat and Axe 1996). Maximum age recorded was 33 years in the Great Barrier Reef (Choat and Robertson 2002a).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 3 - 46 m (Ref. 1602), usually 9 - 46 m (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 45 specimens in 1 taxon.
Water temperature and chemistry ranges based on 40 samples.

Environmental ranges
  Depth range (m): 0.7625 - 52
  Temperature range (°C): 25.245 - 29.336
  Nitrate (umol/L): 0.045 - 1.522
  Salinity (PPS): 34.143 - 35.383
  Oxygen (ml/l): 4.406 - 4.772
  Phosphate (umol/l): 0.085 - 0.254
  Silicate (umol/l): 0.829 - 4.599

Graphical representation

Depth range (m): 0.7625 - 52

Temperature range (°C): 25.245 - 29.336

Nitrate (umol/L): 0.045 - 1.522

Salinity (PPS): 34.143 - 35.383

Oxygen (ml/l): 4.406 - 4.772

Phosphate (umol/l): 0.085 - 0.254

Silicate (umol/l): 0.829 - 4.599
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 3 - 46m.
From 3 to 46 meters.

Habitat: reef-associated. Juveniles inhabit protected bays and lagoons, singly or in small groups in as little as 3 m; adults on seaward reefs from 9 to about 46 m. Usually seen over sandy bottom; sometimes seen in small groups. Feeds on surface film of detritus, diatoms, and fine filamentous algae covering sand and bare rock. The species is rarely poisonous (Ref. 4795).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Species usually found in fairly deep water, about 30 feet or more.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Gas-bubble Disease (e.). Others
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Acanthurus olivaceus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 24
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Acanthurus olivaceus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTTTATTTAGTATTCGGTGCTTGAGCTGGGATAGTAGGAACGGCCTTAAGCCTCCTGATCCGAGCAGAATTAAGCCAACCAGGCGCCCTCTTAGGGGATGATCAAATTTATAATGTAATTGTTACAGCACACGCATTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGTGGGTTTGGAAATTGATTAATTCCACTAATGATTGGAGCCCCTGATATAGCATTCCCACGAATAAATAATATGAGCTTTTGACTTCTACCACCATCTTTTCTGCTCCTACTTGCATCCTCTGCAGTAGAATCAGGTGCTGGAACAGGCTGAACAGTTTACCCCCCTCTAGCCGGTAATCTTGCACATGCAGGAGCATCTGTAGACCTGACTATTTTCTCCCTTCACCTCGCAGGAATTTCCTCAATTCTTGGGGCCATTAACTTTATTACAACAATTATTAACATGAAACCTCCTGCCACTTCTCAGTACCAAACTCCTCTATTCGTATGAGCAGTATTAATTACTGCCGTCCTTCTCCTCCTCTCACTTCCTGTTCTTGCTGCAGGCATCACAATATTACTCACAGATCGAAACCTAAATACTACCTTCTTTGACCCGGCAGGCGGCGGAGATCCGATCCTATACCAACACTTAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
Russell, B., McIlwain, J., Choat, J.H., Abesamis, R., Clements, K.D., Myers, R., Nanola, C., Rocha, L.A. & Stockwell, B.

Reviewer/s
Davidson, L., Edgar, G. & Kulbicki, M.

Contributor/s

Justification
Acanthurus olivaceus is widely distributed and is moderately common. It is a minor component of the aquarium trade and is landed in fish markets. There are no apparent major threats and its distribution overlaps with several marine protected areas. It is therefore listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Acanthurus olivaceus is common in most of its range (G. Allen pers. comm.). It was recorded as occasional in terms of relative abundance in Milne Bay Province and northern Bismarck Sea, Papua New Guinea (Allen 2003, 2009). It is moderately common on mixed sand reef at Raja Ampat, Indonesia (Allen 2003b). It is common in the American Samoa National Park (National Park of Samoa Checklist of Fishes accessed 21 April 2010). It is rare in Calamianes Islands and Puerto Princesa City, Philippines (Werner and Allen 2000, Palawan Council for Sustainable Development unpub. data). It is common and abundant in the Spratly Islands and Tubbataha, Philippines (S. Conales, Jr. pers. comm. 2010).

At Moorea, French Polynesia, SPOT satellite images allowed estimation of the surface area of fringing reef (1,076 ha), barrier reef (3,788 ha) and outer slope (493 ha). A total of 23,132 individuals were recorded in this area in fish visual surveys conducted from 1990-1993 (Lecchini et al. 2006). The Acanthuridae family was dominant on the barrier reef (2.30 ind. m-2) and on the outer slope, (1.61 spec. m-2). On the outer slope, this species accounted for 7.5% of the total density (Moussa 2009).

It is moderately common in Guam and Saipan particularly on exposed coasts. It comprises 3% of the total Acanthurid density in both Guam and Saipan (J. McIlwain unpub. data). 3,000 kg were landed in Hawaii each year in commercial landings (Hawaii Division of Aquatic Resources unpub. data). In Guam it comprises 5%, and Saipan 2%, of the Acanthurid fishery (Guam Division of Aquatic and Wildlfe Resources and P. Houk unpub. data). It is a minor component of the fishery in Pohnpei (Rhodes et al. 2008).

This species is one of the eight most collected aquarium fish in West Hawaii. The total number of individuals caught from FY 2005-2009 was 5,195 with a total value of $9, 654. There was a non-significant decrease in overall density across Fish Replenishment Areas (FRAs) surveyed from 1999-2009. However, the FRAs were shown to be effective in terms of increases inside the FRAs relative to long term marine protected areas (Walsh et al. 2010).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats known for this species.

Surgeonfishes show varying degrees of habitat preference and utilization of coral reef habitats, with some species spending the majority of their life stages on coral reef while others primarily utilize seagrass beds, mangroves, algal beds, and /or rocky reefs. The majority of surgeonfishes are exclusively found on coral reef habitat, and of these, approximately 80% are experiencing a greater than 30% loss of coral reef area and degradation of coral reef habitat quality across their distributions. However, more research is needed to understand the long-term effects of coral reef habitat loss and degradation on these species' populations. Widespread coral reef loss and declining habitat conditions are particularly worrying for species that recruit into areas with live coral cover, especially as studies have shown that protection of pristine habitats facilitate the persistence of adult populations in species that have spatially separated adult and juvenile habitats (Comeros-Raynal et al. 2012).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for this species. However, its distribution overlaps several marine protected areas within its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquarium: commercial
  • Miyasaka, A. 1993 A database on scientific and common names of fishes exported from Hawaii. The information was derived from the above mentioned database. A printout of the names is also available from the State of Hawaii, Department of Land and Natural Resources, 1151 Punchbowl Street, Honolulu, Hawaii. (Ref. 5358)   http://www.fishbase.org/references/FBRefSummary.php?id=5358&speccode=4306 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Acanthurus olivaceus

Acanthurus olivaceus, also known as Orange band Surgeonfishor Orange-shoulder Surgeonfish, is a member of the family Acanthuridae, the surgeonfishes. It lives in tropical waters of the Indo-west Pacific.[2]

Acanturus olivaceus

References[edit]

  1. ^ Russell, B., McIlwain, J., Choat, J.H., Abesamis, R., Clements, K.D., Myers, R., Nanola, C., Rocha, L.A. & Stockwell, B. (2012). "Acanthurus olivaceus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 3 May 2014. 
  2. ^ "Acanthurus olivaceus: Distribution". Encyclopedia of Life. Retrieved 3 May 2014. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!