Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Description

  Common names: devil ray (English), mobula (English), manta (Espanol)
 
Mobula japanica (Müller & Henle, 1841)

Spinetail mobula,     Spinetail devil ray


Disc strongly rhomboidal, much wider than long; wings strongly pointed; head wide, projecting from disc; pectoral fins extend along head and form two large soft horns; front margin of pectoral fin ends under spiracle; a short keel present over the spiracle; eyes and spiracles on side of head; mouth ventral; teeth on both jaws; length of tooth bands ~ 75% of mouth width; teeth long, twice as long as wide, scattered; filter plates of gills with 18-25 side lobes, last lobe leaf shaped, plates separate at tips; tail with small dorsal fin at base long, slender, as long as or longer than disc width, its base oval, with 1 large serrated spine, plus a row of soft tubercles along each side; denticles on upper surface of body dense.


Upper surface dark blue to black; dark inside mouth; lower surface white; dorsal fin black with white tip; tubercles on sides of tail white.

Size: 310 cm wide.

Habitat: pelagic in coastal and oceanic waters.

Depth: to 30 m.

Circumtropical; southern California to Peru (except the Gulf of California)    
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Found inshore, possibly in oceanic waters (Ref. 9911). Pelagic (Ref. 58302). Occurs singly or in groups (Ref. 9911). Feeds mainly on euphausiids (mainly Nictiphanes simplex), and to a lesser extent on copepods and crustacean larvae. May also feed on small fishes. Ovoviviparous (Ref. 50449). Acoustic tracks record the species to spend time above the thermocline at night to feed on krill (H. Dewar, pers.comm. 05/2000). Very common by-catch of the gillnet fisheries targeting skpjack tuna (Katsuwonus pelamis). Utilized for its gill filter plates (very high value), meat, cartilage and skin (Ref.58048).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Depth

Depth Range (m): 0 (F) - 30 (F)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, TEP non-endemic, Circumtropical ( Indian + Pacific + Atlantic Oceans), "Transpacific" (East + Central &/or West Pacific), West + East Pacific (but not Central), East Pacific + Atlantic (East +/or West), East Pacific + all Atlantic (East+West)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Continent, Continent only

Residency: Resident

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo), South Temperate (Peruvian Province )
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Possibly circumglobal in temperate and tropical waters. Apart from confirmed occurrences (see Distribution) the species possibly occurs in the North Atlantic (Notarbartolo-di-Sciara 1987) and given its documented occurrence from places such as Fiji and Tuvalu, it is most certainly present in the waters of many countries in the South Pacific. It was only recently confirmed from Australian waters (Kyne et al. 2005).

The southern Gulf of California is believed to serve as an important spring and summer mating and feeding ground for adults (Notarbartolo-di-Sciara 1988). Pupping appears to take place offshore, Ebert (2003) suggesting around offshore islands or seamounts.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: off South Africa, the Arabian Sea eastward to the Hawaiian Islands and Polynesia. Eastern Pacific: on the continental coast. Eastern Atlantic: Côte d'Ivoire but may probably be more wide-ranging. This has to be critically compared with Mobula mobular of the Mediterranean Sea and nominally elsewhere in the North Atlantic.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Circumglobal in warm seas, including Hawaiian Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Size

Length max (cm): 310.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 3100 mm WD
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

310 cm WD (male/unsexed; (Ref. 50641)); 240 cm WD (female)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Dark blue to black above, white below. Inner surface of cephalic fins silver grey with black tip, outer surface and side behind eye white (Ref. 11228). Shared characters between M. rancureli and Mobula japanica: teeth, placoid scales, and branchial filter morphologies, morphometrics, presence of tail spine, distinctive shape and coloration of dorsal fin, and general shape of body and coloration (Ref. 50641).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Salinity: Marine, Marine Only

Inshore/Offshore: Offshore, In & Offshore, Inshore

Water Column Position: Surface, Near Surface, Water column only

Habitat: Water column

FishBase Habitat: Pelagic
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Information on the biology of Mobula japanica is extremely limited. The species is found inshore, offshore and possibly in oceanic environments, but the movement patterns within its range are little known. Most observations and landings are coastal (Compagno and Last 1999). Notarbartolo-di-Sciara (1988) suggested that this species may be able to tolerate lower water temperatures than other mobulids. Although it is observed in small aggregations, it is not believed to be a schooling species. Size, but not sexual, segregation has been observed within the Gulf of California, México (Notarbartolo-di-Sciara 1988).

Mobula japanica attains at least 310 cm DW but is usually smaller than 250 cm DW. The reproductive mode within this family is aplacental viviparity and the species possesses only a single functional ovary. Embryos obtain nutrients initially by yolk, then through absorption of enriched uterine fluid from the mother (Wourms 1977). Size at birth ranges between 70 and 85 cm DW (Notarbartolo-di-Sciara 1988, Compagno and Last 1999). In Indonesia, males mature between 205 and 210 cm DW, and one pregnant female contained a single embryo 50 cm DW (W. White unpublished data). In the Gulf of California, males appeared to reach sexual maturity at ~210 cm DW and females by ~207 cm DW based on follicle size.

There is no published information on the age and growth of this species.

The species is planktivorous with stomach contents containing 99.6% euphausiids (Nyctiphanes simplex) from April through July (Notarbartolo-di-Sciara 1988).

In the area around Bahia de la Ventana (southern Gulf of California, México) individuals are found from April through late summer, with a peak of abundance in late summer (Notarbartolo-di-Sciara 1988). Seasonally later occurrence than M. thurstoni in the Bahia la Ventana region suggests resource competition avoidance (Notarbartolo-di-Sciara 1988). Movement patterns and migrations of mobulids are not well understood.

Life history parameters
Age at maturity (years): Unknown.
Size at maturity (disc width): Female: Gulf of California: ~207 cm DW (Notarbartolo-di-Sciara 1988); Male: 205 to 210 cm DW (Indonesia) (W. White unpublished data), ~210 cm DW (Gulf of California) (Notarbartolo-di-Sciara 1988).
Longevity (years): Unknown.
Maximum size (disc width): 310 cm DW.
Size at birth: 70 to 85 cm DW (Notarbartolo-di-Sciara 1988, Compagno and Last 1999).
Average reproductive age (years): Unknown.
Gestation time (months): Unknown.
Reproductive periodicity: Unknown.
Average annual fecundity or litter size: 1 pup/litter (W. White unpublished data).
Annual rate of population increase: Unknown.
Natural mortality: Unknown.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine, usually 0 - 200 m (Ref. 89423)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Feeding

Feeding Group: Planktivore

Diet: Pelagic crustacea, zooplankton, pelagic fish eggs, pelagic fish larvae, bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Found inshore, possibly in oceanic waters. Occurs singly or in groups. Feeds mainly on euphausids (mainly Nictiphanes simplex), and to a lesser extent on copepods and crustacean larvae. May also feed on small fishes.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Exhibit ovoviparity (aplacental viviparity), with embryos feeding initially on yolk, then receiving additional nourishment from the mother by indirect absorption of uterine fluid enriched with mucus, fat or protein through specialised structures (Ref. 50449). With one in a litter (Ref. 12951). Size at birth 85-92 cm WD (Ref. 12951, Ref.58048).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Egg Type: Live birth, No pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Mobula japanica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTTTACTTAGTCTTTGGTGCATGAGCAGGGATAGTGGGTACTGGTCTTAGCCTGCTAATTCGAACAGAATTAAGCCAGCCAGGAGCCTTACTAGGTGACGACCAAATCTATAATGTGATCGTTACTGCCCATGCTTTTGTAATAATTTTCTTTATAGTGATACCAATTATAATTGGTGGGTTTGGTAATTGACTAGTCCCCTTAATAATTGGTGCTCCAGATATAGCCTTTCCACGAATAAACAACATAAGCTTTTGACTTCTTCCTCCATCCTTCCTTTTATTATTAGCTTCAGCAGGAGTAGAAGCTGGAGCTGGAACCGGATGAACCGTCTATCCTCCCCTGGCTGGTAATCTAGCACATGCTGGAGCCTCTGTAGATCTTACTATCTTTTCCCTACACTTAGCTGGGGTTTCCTCCATTTTAGCATCCATCAATTTCATTACTACTATTATTAATATGAAACCACCTGCAATCTCTCAATATCAAACACCATTATTTGTCTGATCTATCCTAATTACAACTGTCCTTCTCTTATTATCCCTCCCAGTCCTAGCAGCAGGCATTACCATACTCCTTACAGATCGTAATCTTAATACAACTTTCTTTGACCCAGCAGGAGGTGGTGACCCCATTCTTTATCAACATCT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Mobula japanica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 21
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Mobula japonica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List: Listed, Near threatened

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2006

Assessor/s
White, W.T., Clark, T.B., Smith, W.D. & Bizzarro, J.J.

Reviewer/s
Kyne, P.M., Notarbartolo-di-Sciara, G., Fowler, S.L. & Compagno , L.J.V. (Shark Red List Authority)

Contributor/s

Justification
Mobula japanica is probably circumglobal in all temperate and tropical seas, but its distribution is not completely defined. It is a large devil ray (reaching 310 cm disc width) of inshore, offshore and possibly oceanic environments. Mobula japanica is highly susceptible to gillnets and is known to be landed in Indonesia, México and the Philippines and likely elsewhere across its range. It is a common component of the inshore pelagic tuna gillnet fishery in Indonesia where the flesh and gill rakers are utilised. The high value of gill rakers, which are dried and exported for the Asian medicinal market, has resulted in recent dramatic increases in fishing for mobulids in Indonesia with targeting now occurring. In the Gulf of California, México, the species is also landed when targeted with harpoons and as bycatch from gillnets. In the Philippines the species was historically targeted in a mixed mobulid fishery, and while a ban on fishing for devil rays is presently in place, enforcement is insufficient and landings still occur. Information on catches is not available from other parts of its range, but it is likely being captured elsewhere, certainly in Southeast Asia where target fisheries for whale sharks and manta rays operate. While few species composition data are available (limiting the assessment of current fishing pressures on populations), increased targeting and catches in Indonesia, which may mirror increases elsewhere, is cause for great concern and requires urgent international conservation measures as the species is unlikely to be able to tolerate present levels of exploitation. Its large size and fecundity of a single pup per litter emphasizes the limited reproductive potential and low productivity of this species. Mobula japanica is assessed as Near Threatened globally, but Vulnerable throughout Southeast Asia where catches and demand are increasing. Vulnerable listings may also be warranted elsewhere if future studies show declines in populations where fished.

History
  • 2003
    Near Threatened
    (IUCN 2003)
  • 2003
    Near Threatened
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
No information available. Reported as locally common by Compagno and Last (1999), but probably rare in some parts of its range, for example Australia where it has been documented only from two records (Kyne et al. 2005).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Mobula japanica is highly susceptible to gillnets and is taken, either as bycatch or as a target species in Indonesia, México and the Philippines. Juveniles could also be incidentally captured in trawl fisheries. While information is available on these areas it is likely to be landed in other countries also, such as West Africa and particularly in Southeast Asia where pressure on the marine environment is considerable and where mobulid gill rakers are a high value product. It is reported to be taken as longline bycatch in the Gulf of Aden (Bonfil and Abdallah 2004).

Mobula japanica is a common catch in the inshore pelagic tuna gillnet fisheries of Indonesia and is also taken by purse seine in that country. The high value of gill rakers in some areas, e.g., Pelabuhanratu in West Java (W. White unpublished data), is driving a dramatic increase in the catch of mobulids in Indonesia where some fishers are now targeting devil rays. When shark catches are lower (off-season, December to March) fishers are landing more mobulids as an alternative (W. White pers. obs.). The flesh is also utilized both for human consumption and as bait and chum for longlines.

The species is caught in artisanal drift and demersal gillnet fisheries and directly targeted using harpoons in the Gulf of California. Mobula japanica represented 30% of the catch of mobulids observed during a survey of artisanal landings in Bahia de la Ventana, southwestern Gulf of California (Notarbartolo-di-Sciara 1988). This was second to M. thurstoni, which represented 58% of the catch. Mean daily capture of M. japanica in Bahia de la Ventana from March to July 1983 was: March: 0.0, April: 0.4, May: 0.4, June: 1.7, July: 4.3 (Notarbartolo-di-Sciara 1988). Seventeen individuals were noted among landings of 12 pangas at Punta Arena de la Ventana in June 2001 (J. Bizzarro pers. obs.). There is still an active mobulid fishery in the southwest Gulf of California, south of La Paz and devil rays are also landed in nearshore artisanal elasmobranch fisheries throughout the Gulf of California.

Mobula japonica comprised 37% of the Philippine mobulid fishery during 2002 (Bureau of Fisheries and Aquatic Resources, unpublished study), which may reflect its relative importance in other target fisheries in the Southeast Asia region. There is currently a ban on fishing for manta rays in the Philippines, but the effectiveness of this ban is questionable due to limited enforcement ability and mobulids are still being taken illegally.

Mobula japanica is not likely to be able to tolerate high catch levels, given its low reproductive potential. Increasing catches of mobulids in Indonesia, which may mirror increases elsewhere, is of great concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Near Threatened (NT)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Additional research is needed to quantify the extent of target and non-target fisheries take for this species throughout its range. Because of its large size, migratory behavior, extremely low fecundity and large size at maturity, this species is likely highly vulnerable to fishing pressure. However, available life history information is limited and more research is required to make a more accurate assessment of the threat posed by fisheries.

In México, a moratorium on the issue of elasmobranch fishing permits was issued in 1993, but no formal management plan has been implemented for Mobula japanica specifically or most other chondrichthyans. However, legislation is currently being developed in México to establish national elasmobranch fishery management.

Elasmobranch landings in most parts of the world generally lack species-specific details (for example in México, batoids are broadly grouped as ?manta raya?). Improved clarity in catch records would provide a basis for detecting potential trends in effort and landings.

In the Philippines, fishing for mobulids was banned in 1998, however it was lifted in 1999 to study the fishery. The ban was put back in place in 2002, and currently it is illegal to fish for any Manta or Mobula in Philippine waters. However, enforcement is insufficient and mobulids are still being taken illegally.

Elasmobranch fisheries are generally unmanaged throughout Central America and Southeast Asia and indeed elsewhere in the range of this species, and attempts to regulate fisheries in these regions would greatly improve conservation of M. japanica and other chondrichthyans.

The development and implementation of management plans (national and/or regional e.g., under the FAO International Plan of Action for the Conservation and Management of Sharks: IPOA?Sharks) are required to facilitate the conservation and sustainable management of all chondrichthyan species across the regions where this ray occurs.

The vulnerability of mobulids and increasing catches requires urgent international conservation measures. These will need to focus on harvest and trade management.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Spinetail mobula

Mobula japanica, commonly known as the spinetail mobula or devil ray, is a species of pelagic marine fish which belongs to the family Myliobatidae found throughout the tropical and sub-tropical waters of the Indo-Pacific and eastern Atlantic Ocean.[1] The spinetail mobula is dark blue to black above and white below. Some distinctive points of the spinetail mobula are that its head projects from the disk, the inner surface of the cephalic fins (horns) are silver-grey with black tips, while the outer surface and side behind eye is white.[2]It also has a tail spine.[3]

References[edit]

  1. ^ http://eol.org/pages/211465/details#distribution
  2. ^ http://eol.org/pages/211465/details#habitat
  3. ^ http://eol.org/pages/211465/details#comprehensive_description

Sources[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!