Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Description

  Common names: surgeonfish (English), cirujano (Espanol), navajón (Espanol)
 
Acanthurus guttatus Forster, 1801


Whitespotted Surgeonfish



Body an elongate oval; head profile steep; eye high on the head; mouth small, protrusible, low on head; teeth on jaws fixed, with flattened, notched tips, 8-28 on each jaw; gill rakers 21-24; dorsal rays IX, 27-30; anal rays III, 23-26; pectoral rays 15-17; pelvic fin I, 5; a single depressible spine fits into a groove on the side of the base of the tail; tail fin concave; scales very small, rough; lateral line complete.

Head, body and dorsal and anal fins dark grey brown; a white bar on head behind eye and another on body just behind pectoral base; dorsal, anal and body behind second bar with many small white spots; pelvic fins bright yellow; tail fin pale yellow with a broad black rear edge.

Reaches 26 cm

Habitat: Restricted to shallow surgy areas of seaward reef environments.

Depth range: 0-10 m

Widely distributed throughout the tropical Indo-central Pacific but, in the tropical eastern Pacific is known only from Clipperton. The first record of this species in the Tropical Eastern Pacific was made by Philippe Bearez  and Bernard Séret (during the Jean-Louis Etienne Expedition), who observed three large adults, and collected one of them, during March, 2005. Since only a few similar-sized individuals were seen this species is probably present as a vagrant. This conspicuous, readily recognizable species was not observed at Clipperton during expeditions there in 1994 and 1998 by DR Robertson.

   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Occurs in surge zone of clear seaward reefs (Ref. 9710, 58302). Benthopelagic (Ref. 58302); mainly oceanic and found schooling in shallow depths over reef flats subject to surge or currents (Ref. 48637). Browses on filamentous and calcareous algae. Forms schools.
  • Randall, J.E. 1956 A revision of the surgeonfish genus Acanthurus. Pac. Sci. 10(2):159-235. (Ref. 1920)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Acanthurus guttatus is found from the Hawaiian Islands and Pitcairn Islands, westwards to Maldive Islands, Chagos Archipelago, Mascarenes and the Seychelles, northwards to the Ryukyu Islands, Japan and southwards to the Great Barrier Reef, Australia and New Caledonia. It has been recorded from Rapa Island.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, TEP non-endemic, Indo-Pacific only (Indian + Pacific Oceans), "Transpacific" (East + Central &/or West Pacific)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Island (s), Island (s) only

Residency: Vagrant

Climate Zone: Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: oceanic islands in the western Indian Ocean to the Hawaiian, Marquesan and Tuamoto islands, north to the Ryukyu Islands, south to New Caledonia and Rapa.
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: Mascarenes, Maldives and Chagos Archipelago east to Hawaiian Islands, Marquesas Islands and Tuamotu Archipelago, north to Ryukyu Islands, south to New Caledonia and Rapa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth

Depth Range (m): 0 (S) - 10 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 27 - 30; Analspines: 3; Analsoft rays: 23 - 26
  • Randall, J.E. 1956 A revision of the surgeonfish genus Acanthurus. Pac. Sci. 10(2):159-235. (Ref. 1920)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length max (cm): 26.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 260 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

26.0 cm TL (male/unsexed; (Ref. 9710))
  • Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Occurs in surge zones and browses on filamentous and calcareous algae. Occasionally forms schools.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Preserved color is brown; spotted, white spots usually bordered with dark brown (may help conceal it in turbulent water that is often filled with small bubbles). Pelvic fins bright yellow. Each side of caudal peduncle with a single, sharp, forward-pointing erectile spine. Gill rakers on anterior row: 21-24; gill rakers on posterior row: 19-23.
  • Randall, J.E. 1956 A revision of the surgeonfish genus Acanthurus. Pac. Sci. 10(2):159-235. (Ref. 1920)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Acanthurus guttatus inhabits the surge zone in exposed reefs or rocky shores, usually in small schools. It is non-territorial (Craig 1998). It browses mainly on filamentous algae, but ingests some calcareous algae such as Jania (Randall 2001). It is classified as a grazer (Choat and Bellwood pers. obs. in Green and Bellwood 2009).

Reproduction

The sexes are separate among the acanthurids (Reeson 1983). This species was observed to spawn year round in American Samoa. Spawning occured in or adjacent to the outlet channel of the reef flat where water currents flowed in a seaward direction. It migrated to a specific area in the outer reef channel and spawned above several large coral blocks in waters 4-7 m deep. Groups of 50-500 fish began spawning near sunset (Craig 1998). It forms spawning aggregations (Sadovy et al. 2008).


Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 1 - 6 m (Ref. 9710)
  • Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 36 specimens in 1 taxon.
Water temperature and chemistry ranges based on 35 samples.

Environmental ranges
  Depth range (m): 0.61 - 20
  Temperature range (°C): 25.245 - 29.336
  Nitrate (umol/L): 0.019 - 0.402
  Salinity (PPS): 34.134 - 36.142
  Oxygen (ml/l): 4.454 - 4.764
  Phosphate (umol/l): 0.092 - 0.301
  Silicate (umol/l): 0.829 - 4.752

Graphical representation

Depth range (m): 0.61 - 20

Temperature range (°C): 25.245 - 29.336

Nitrate (umol/L): 0.019 - 0.402

Salinity (PPS): 34.134 - 36.142

Oxygen (ml/l): 4.454 - 4.764

Phosphate (umol/l): 0.092 - 0.301

Silicate (umol/l): 0.829 - 4.752
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 6m.
Recorded at 6 meters.

Habitat: reef-associated. Occurs in surge zone of clear seaward reefs (Ref. 9710). Browses on filamentous and calcareous algae. Forms schools.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Bottom

Habitat: Reef (rock &/or coral), Reef only, Reef associated (reef + edges-water column & soft bottom)

FishBase Habitat: Reef Associated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Found in turbulent waters in shallow reef areas. In atolls, commonly found schooling in surge areas. Is both a browser and a grazer (Ref. 275).
  • Randall, J.E. 1956 A revision of the surgeonfish genus Acanthurus. Pac. Sci. 10(2):159-235. (Ref. 1920)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Feeding

Feeding Group: Herbivore

Diet: benthic microalgae
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Acanthurus guttatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTTTATTTAGTATTTGGTGCTTGAGCTGGAATAGTAGGAACGGCTCTAAGCCTCCTAATCCGGGCAGAATTAAGCCAACCAGGCGCCCTCCTCGGGGATGACCAAATTTATAATGTAATTGTTACAGCACACGCATTCGTAATGATTTTCTTTATAGTAATACCAATTATGATTGGTGGATTTGGAAATTGATTAATTCCATTAATGATTGGAGCTCCTGACATGGCATTCCCACGAATGAATAATATGAGCTTTTGACTTCTACCACCATCCTTCCTACTTCTACTTGCATCCTCTGCAGTAGAATCTGGTGCTGGAACAGGGTGAACAGTCTATCCCCCTCTAGCCGGAAATCTCGCACATGCGGGAGCATCTGTAGACCTTACTATTTTCTCCCTTCACCTCGCAGGAATTTCTTCAATTCTTGGAGCTATTAATTTTATTACAACAATTATTAATATGAAACCTCCTGCTATTTCTCAATACCAAACCCCTCTGTTTGTATGAGCAGTACTAATTACTGCCGTTCTACTCCTCCTCTCACTCCCCGTTCTTGCTGCTGGTATTACAATACTACTTACAGATCGAAACCTAAATACTACCTTCTTTGACCCAGCAGGTGGAGGAGACCCCATTCTATATCAACACTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Acanthurus guttatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
Abesamis, R., Clements, K.D., Choat, J.H., McIlwain, J., Myers, R., Nanola, C., Rocha, L.A., Russell, B. & Stockwell, B.

Reviewer/s
Davidson, L., Edgar, G. & Kulbicki, M.

Contributor/s

Justification
Acanthurus guttatus is widely distributed throughout the Indo-Pacific. It is moderately common throughout its range. It is not specifically targeted in any fishery. There are no major threats known for this species and it occurs in marine protected areas in parts of its distribution. It is therefore listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Acanthurus guttatus was recorded as occasional in terms of relative abundance in the northern Bismarck Sea, Papua New Guinea (Allen 2009). It is common in the American Samoa National Park (National Park of Samoa Checklist of Fishes accessed 21 April 2010). It is also common on the exposed coast of Guam. It is a minor component of the fishery in both Guam and Saipan (J. McIlwain pers. comm. 2010).

In American Samoa, landings of acanthurids (surgeonfish) totalled 13,431 lbs or 9% of the total catch. 27 lbs were landed in study areas from July 1990 through to June 1991. Densities are most likely underestimated as these were harvested primarily by night divers (Ponwith 1991).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats known for this species.

Surgeonfishes show varying degrees of habitat preference and utilization of coral reef habitats, with some species spending the majority of their life stages on coral reef while others primarily utilize seagrass beds, mangroves, algal beds, and /or rocky reefs. The majority of surgeonfishes are exclusively found on coral reef habitat, and of these, approximately 80% are experiencing a greater than 30% loss of coral reef area and degradation of coral reef habitat quality across their distributions. However, more research is needed to understand the long-term effects of coral reef habitat loss and degradation on these species' populations. Widespread coral reef loss and declining habitat conditions are particularly worrying for species that recruit into areas with live coral cover, especially as studies have shown that protection of pristine habitats facilitate the persistence of adult populations in species that have spatially separated adult and juvenile habitats (Comeros-Raynal et al. 2012).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for this species. Its distribution overlaps several marine protected areas in parts of its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquarium: commercial
  • Miyasaka, A. 1993 A database on scientific and common names of fishes exported from Hawaii. The information was derived from the above mentioned database. A printout of the names is also available from the State of Hawaii, Department of Land and Natural Resources, 1151 Punchbowl Street, Honolulu, Hawaii. (Ref. 5358)
  • Titcomb, M. 1972 Native use of fish in Hawaii. The University Press of Hawaii, Honolulu, Hawaii, USA. 175 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Acanthurus guttatus

The Whitespotted surgeonfish or (Acanthurus guttatus) is a marine reef tang in the fish family Acanthuridae. It is found in shallow waters on reefs in the Indo-Pacific.

Contents

Description

The whitespotted surgeonfish is deep-bodied and laterally compressed. The basic colour is grey which darkens towards the posterior and the body is liberally spotted with white. There is a band of white just behind the eye stretching from the operculum to the nape of the neck. Another white band encircles the fish just behind the yellow pelvic fins. The other fins are dark coloured except for the rather small caudal fin which is half pale yellow and half black. The dorsal fin has 9 spines and 27 to 30 soft rays. The anal fin has 3 spines and 23 to 26 rays and the pectoral fin has 17 to 20 rays. The fish grows to a maximum length of 26 cm (10 in).[2][3]

Distribution and habitat

The whitespotted surgeonfish is found in shallow water in the Indo-Pacific. Its native range extends from Mauritius to southern Japan, Indonesia and northern Australia but in 2003, it was observed off the coast of Florida in the vicinity of Palm Beach. Its main habitat is exposed reefs and rocky shores where it occurs in groups. Its spots may provide camouflage in the churned up, bubble-filled water.[2]

Biology

The whitespotted surgeonfish feeds on filamentous algae and calcareous algae. It is considered to form an important link between algae, the primary producers in the ocean, and the detrital food web in the Pacific Ocean.[1][2]

In American Samoa, breeding takes place all year round with eggs being deposited in drainage channels in the reef at dusk.[2]

References

  1. ^ a b Bailly, Nicolas (2010). "Acanthurus guttatus Forster, 1801". World Register of Marine Species. http://www.marinespecies.org/aphia.php?p=taxdetails&id=219650. Retrieved 2012-02-27.
  2. ^ a b c d Acanthurus guttatus, Forster 1801: Whitespotted Surgeonfish USGS. Retrieved 2012-02-27.
  3. ^ Froese, Rainer, and Daniel Pauly, eds. (2005). Acanthurus guttatus in FishBase. May 2005 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!