Overview

Comprehensive Description

Biology

Occurs in surge zone of clear seaward reefs (Ref. 9710, 58302). Benthopelagic (Ref. 58302); mainly oceanic and found schooling in shallow depths over reef flats subject to surge or currents (Ref. 48637). Browses on filamentous and calcareous algae. Forms schools.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Common names: surgeonfish (English), cirujano (Espanol), navajón (Espanol)
 
Acanthurus guttatus Forster, 1801


Whitespotted Surgeonfish



Body an elongate oval; head profile steep; eye high on the head; mouth small, protrusible, low on head; teeth on jaws fixed, with flattened, notched tips, 8-28 on each jaw; gill rakers 21-24; dorsal rays IX, 27-30; anal rays III, 23-26; pectoral rays 15-17; pelvic fin I, 5; a single depressible spine fits into a groove on the side of the base of the tail; tail fin concave; scales very small, rough; lateral line complete.

Head, body and dorsal and anal fins dark grey brown; a white bar on head behind eye and another on body just behind pectoral base; dorsal, anal and body behind second bar with many small white spots; pelvic fins bright yellow; tail fin pale yellow with a broad black rear edge.

Reaches 26 cm

Habitat: Restricted to shallow surgy areas of seaward reef environments.

Depth range: 0-10 m

Widely distributed throughout the tropical Indo-central Pacific but, in the tropical eastern Pacific is known only from Clipperton. The first record of this species in the Tropical Eastern Pacific was made by Philippe Bearez  and Bernard Séret (during the Jean-Louis Etienne Expedition), who observed three large adults, and collected one of them, during March, 2005. Since only a few similar-sized individuals were seen this species is probably present as a vagrant. This conspicuous, readily recognizable species was not observed at Clipperton during expeditions there in 1994 and 1998 by DR Robertson.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-Pacific: oceanic islands in the western Indian Ocean to the Hawaiian, Marquesan and Tuamoto islands, north to the Ryukyu Islands, south to New Caledonia and Rapa.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Chagos, Mauritius, Reunion
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific: Mascarenes, Maldives and Chagos Archipelago east to Hawaiian Islands, Marquesas Islands and Tuamotu Archipelago, north to Ryukyu Islands, south to New Caledonia and Rapa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 0 (S) - 10 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific


 
Global Endemism: All species, TEP non-endemic, Indo-Pacific only (Indian + Pacific Oceans), "Transpacific" (East + Central &/or West Pacific)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Island (s), Island (s) only

Residency: Vagrant

Climate Zone: Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 27 - 30; Analspines: 3; Analsoft rays: 23 - 26
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length max (cm): 26.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 260 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

26.0 cm TL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Preserved color is brown; spotted, white spots usually bordered with dark brown (may help conceal it in turbulent water that is often filled with small bubbles). Pelvic fins bright yellow. Each side of caudal peduncle with a single, sharp, forward-pointing erectile spine. Gill rakers on anterior row: 21-24; gill rakers on posterior row: 19-23.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Occurs in surge zones and browses on filamentous and calcareous algae. Occasionally forms schools.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 1 - 6 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 36 specimens in 1 taxon.
Water temperature and chemistry ranges based on 35 samples.

Environmental ranges
  Depth range (m): 0.61 - 20
  Temperature range (°C): 25.245 - 29.336
  Nitrate (umol/L): 0.019 - 0.402
  Salinity (PPS): 34.134 - 36.142
  Oxygen (ml/l): 4.454 - 4.764
  Phosphate (umol/l): 0.092 - 0.301
  Silicate (umol/l): 0.829 - 4.752

Graphical representation

Depth range (m): 0.61 - 20

Temperature range (°C): 25.245 - 29.336

Nitrate (umol/L): 0.019 - 0.402

Salinity (PPS): 34.134 - 36.142

Oxygen (ml/l): 4.454 - 4.764

Phosphate (umol/l): 0.092 - 0.301

Silicate (umol/l): 0.829 - 4.752
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 6m.
Recorded at 6 meters.

Habitat: reef-associated. Occurs in surge zone of clear seaward reefs (Ref. 9710). Browses on filamentous and calcareous algae. Forms schools.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Bottom

Habitat: Reef (rock &/or coral), Reef only, Reef associated (reef + edges-water column & soft bottom)

FishBase Habitat: Reef Associated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Found in turbulent waters in shallow reef areas. In atolls, commonly found schooling in surge areas. Is both a browser and a grazer (Ref. 275).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeding

Feeding Group: Herbivore

Diet: benthic microalgae
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Acanthurus guttatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTTTATTTAGTATTTGGTGCTTGAGCTGGAATAGTAGGAACGGCTCTAAGCCTCCTAATCCGGGCAGAATTAAGCCAACCAGGCGCCCTCCTCGGGGATGACCAAATTTATAATGTAATTGTTACAGCACACGCATTCGTAATGATTTTCTTTATAGTAATACCAATTATGATTGGTGGATTTGGAAATTGATTAATTCCATTAATGATTGGAGCTCCTGACATGGCATTCCCACGAATGAATAATATGAGCTTTTGACTTCTACCACCATCCTTCCTACTTCTACTTGCATCCTCTGCAGTAGAATCTGGTGCTGGAACAGGGTGAACAGTCTATCCCCCTCTAGCCGGAAATCTCGCACATGCGGGAGCATCTGTAGACCTTACTATTTTCTCCCTTCACCTCGCAGGAATTTCTTCAATTCTTGGAGCTATTAATTTTATTACAACAATTATTAATATGAAACCTCCTGCTATTTCTCAATACCAAACCCCTCTGTTTGTATGAGCAGTACTAATTACTGCCGTTCTACTCCTCCTCTCACTCCCCGTTCTTGCTGCTGGTATTACAATACTACTTACAGATCGAAACCTAAATACTACCTTCTTTGACCCAGCAGGTGGAGGAGACCCCATTCTATATCAACACTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Acanthurus guttatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Acanthurus guttatus

The Whitespotted surgeonfish or (Acanthurus guttatus) is a marine reef tang in the fish family Acanthuridae. It is found in shallow waters on reefs in the Indo-Pacific.

Contents

Description

The whitespotted surgeonfish is deep-bodied and laterally compressed. The basic colour is grey which darkens towards the posterior and the body is liberally spotted with white. There is a band of white just behind the eye stretching from the operculum to the nape of the neck. Another white band encircles the fish just behind the yellow pelvic fins. The other fins are dark coloured except for the rather small caudal fin which is half pale yellow and half black. The dorsal fin has 9 spines and 27 to 30 soft rays. The anal fin has 3 spines and 23 to 26 rays and the pectoral fin has 17 to 20 rays. The fish grows to a maximum length of 26 cm (10 in).[2][3]

Distribution and habitat

The whitespotted surgeonfish is found in shallow water in the Indo-Pacific. Its native range extends from Mauritius to southern Japan, Indonesia and northern Australia but in 2003, it was observed off the coast of Florida in the vicinity of Palm Beach. Its main habitat is exposed reefs and rocky shores where it occurs in groups. Its spots may provide camouflage in the churned up, bubble-filled water.[2]

Biology

The whitespotted surgeonfish feeds on filamentous algae and calcareous algae. It is considered to form an important link between algae, the primary producers in the ocean, and the detrital food web in the Pacific Ocean.[1][2]

In American Samoa, breeding takes place all year round with eggs being deposited in drainage channels in the reef at dusk.[2]

References

  1. ^ a b Bailly, Nicolas (2010). "Acanthurus guttatus Forster, 1801". World Register of Marine Species. http://www.marinespecies.org/aphia.php?p=taxdetails&id=219650. Retrieved 2012-02-27.
  2. ^ a b c d Acanthurus guttatus, Forster 1801: Whitespotted Surgeonfish USGS. Retrieved 2012-02-27.
  3. ^ Froese, Rainer, and Daniel Pauly, eds. (2005). Acanthurus guttatus in FishBase. May 2005 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!