Overview

Comprehensive Description

Biology

Occurs on continental shelves to depths of at least 200 m (Ref. 6871). Migrates into large estuaries and inshore bays in the spring to breed (Ref. 6871). Feeds mainly on shellfish (Ref. 26346). Oviparous (Ref. 50449). Eggs are encased in horny shells (Ref. 205). Flesh is of good eating quality. Males have a small, club-like protuberance on the head and also long copulation organs near the pelvic fins (Ref. 557).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

The Elephant Fishis distributed off southern Australia from Esperance in Western Australia (longitude ~12154E) to about Sydney in New South Wales (latitude ~34S), including Tasmania (Last and Stevens 2009). The species is also distributed around New Zealand.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Southwest Pacific: southern Australia and New Zealand.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Southern Australia and New Zealand.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 1250 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

125 cm TL (male/unsexed; (Ref. 26346))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The Elephant Fish occurs from inshoreto depths of more than 200 m (Last and Stevens 2009), but 99% of the catch by shark gillnets is taken at depths less than 80 m (Walker and Gason 2009). This species is oviparous, laying egg pairs in shallow water that may take up to 10 months to hatch (Last and Stevens 2009). It is a seasonal breeder with females moving to shallower habitats to lay eggs (Francis 1997, Last and Stevens 2009). Eggs are laid over several weeks each year. Juveniles remain in the shallow habitats for up to 3 years, which may make them vulnerable to trawl capture in New Zealand (Francis 1997).Males and females are often caught separately by fishers and hence appear to be segregated most of the year.TheElephant Fishhas medium biological productivity (Morison et al. 2012). Size at which 50% of the animals are mature is 59 cm fork length (FL) for females and 54 cm FL for males, and mature females lay an average of 19.7 eggs per year (Bell 2012). Maximum age is estimated at 11 years in New Zealand (Francis 1997) and 16 years in southern Australia (Brown et al. 2000) from tag release-recapture, at 9 or 20 years in southern Australia depending on method from sectioning dorsal-fin spines (Bell 2012), and at 58 years for males and 89 years for females in New Zealand from analysis of length-frequency composition of catches (Francis 1997).


Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1053 specimens in 1 taxon.
Water temperature and chemistry ranges based on 322 samples.

Environmental ranges
  Depth range (m): 7 - 151
  Temperature range (°C): 7.950 - 17.654
  Nitrate (umol/L): 0.293 - 17.077
  Salinity (PPS): 34.377 - 36.031
  Oxygen (ml/l): 5.146 - 6.351
  Phosphate (umol/l): 0.166 - 1.158
  Silicate (umol/l): 0.677 - 4.926

Graphical representation

Depth range (m): 7 - 151

Temperature range (°C): 7.950 - 17.654

Nitrate (umol/L): 0.293 - 17.077

Salinity (PPS): 34.377 - 36.031

Oxygen (ml/l): 5.146 - 6.351

Phosphate (umol/l): 0.166 - 1.158

Silicate (umol/l): 0.677 - 4.926
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; oceanodromous (Ref. 51243); marine; depth range 0 - 227 m (Ref. 26346)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1053 specimens in 1 taxon.
Water temperature and chemistry ranges based on 322 samples.

Environmental ranges
  Depth range (m): 7 - 151
  Temperature range (°C): 7.950 - 17.654
  Nitrate (umol/L): 0.293 - 17.077
  Salinity (PPS): 34.377 - 36.031
  Oxygen (ml/l): 5.146 - 6.351
  Phosphate (umol/l): 0.166 - 1.158
  Silicate (umol/l): 0.677 - 4.926

Graphical representation

Depth range (m): 7 - 151

Temperature range (°C): 7.950 - 17.654

Nitrate (umol/L): 0.293 - 17.077

Salinity (PPS): 34.377 - 36.031

Oxygen (ml/l): 5.146 - 6.351

Phosphate (umol/l): 0.166 - 1.158

Silicate (umol/l): 0.677 - 4.926
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 227m.
Recorded at 227 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs on continental shelves to depths of at least 200 m. Migrates into large estuaries and inshore bays in the spring to breed (Ref. 6871). Feeds mainly on shellfish (Ref. 26346).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Migrates into large estuaries and inshore bays in the spring to breed (Ref. 6871). Oviparous, two egg cases (Ref. 26346) are laid on sandy or muddy bottoms and take up to 8 months to hatch (Ref. 6871). Embryos feed solely on yolk (Ref. 50449).Young hatch at about 15 cm (Ref. 26346).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 6 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Callorhinchus milii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATTTACTTTTTGGTGCCTGGGCAGGAATAGTTGGTACTGCCCTTAGCCTATTAATTCGAGCTGAACTAAGTCAGCCTGGAGCATTAATAGGTGATGACCAAATCTATAATGTTATTGTTACTGCACATGCCTTTGTAATAATTTTCTTTATAGTTATACCCATTATAATCGGAGGTTTTGGAAACTGATTAATCCCTTTAATAATTGGTGCACCTGATATAGCTTTCCCACGAATAAATAATATAAGTTTCTGATTATTACCTCCTTCCTTTCTTCTTCTTTTAGCCTCTGCAGGAGTTGAAGCTGGAGCAGGAACAGGTTGAACTGTCTATCCACCACTAGCTGGTAACCTTGCACATGCCGGAGCATCCGTAGATTTAACTATCTTCTCCTTACATTTAGCAGGTATCTCATCTATCTTAGCTTCTATTAATTTTATTACAACAATTATTAACATAAAACCCCCATCTATCACGCAATATCAAACACCTTTATTTGTATGATCAATCCTTATTACTACAATTCTTCTCCTACTTTCCCTACCTGTCCTAGCTGCAGGTATCACTATACTACTTACTGATCGTAATCTTAATACAACATTCTTTGATCCGGCTGGAGGAGGAGATCCTATTTTATACCAACACTTANNN
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Callorhinchus milii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 18
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2015

Assessor/s
Walker, T.I., Francis, M.P. & Reardon, M.B.

Reviewer/s
Simpfendorfer, C., Dulvy, N.K. & Kyne, P.M.

Contributor/s

Justification

The Elephant Fish (Callorhinchus milii)is a moderately abundant holocephalan species endemic to the continental shelf of each of southern Australia and New Zealand. The species has medium biological productivity; although maximum age is in the range 920 years, it matures relatively early with females laying ~20 eggs annually.In southern Australia, the species is exploited over its entire range, but most of the catch is taken from Bass Strait by gillnets of mesh-size ranging 66 inches, from southern New South Wales and eastern Victoria by demersal otter trawl and Danish seine, and the Great Australian Bight by demersal otter trawl. Current exploitation rates are considered sustainable. Ongoing commercial catch per unit effort from shark gillnet fishing has been stablesince 1981, following an earlier decline. Fishing effort and catch have reduced with implementation of a Total Allowable Catch for Elephant Fishsince 2002. In addition to these specific measures a series of general protections are in place reducing effort on this species, including (1) a three-mile closure of all Victorian waters to shark gillnet fishing provides a large refuge for the species; and (2) a prohibition of demersal otter trawl and Danish seining, and in some areas all other fishing methods, in extensive Commonwealth marine reserves. In New Zealand, TACs first implemented in 1986 subsequently led to increasing catch per unit effort. The fishery is stable with the population likely to be above the biomass required to provide the maximum sustainable yield.On the basis of the stable populations and active management of this species it is assessed as Least Concern


History
  • 2003
    Least Concern (LC)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
For this assessment it is assumed that a single genetic stock occurs in southern Australia and a separate single genetic stock in New Zealand, with no mixing between the two stocks.
Catch per unit effort as reported by commercial fishers (where catch refers to carcass mass, i.e. headed, eviscerated and fins removed), peaked at 2.13.5 kg per km-lift during 197479, but subsequently declined to below half these levels and stabilized at 0.81.1 kg per km-lift (Walker and Gason 2009). There is also an annual assessment of this species that uses catch rates from the Australian gillnet fishery.Standardized catch rates have been variable since 1980. From 2005 to 2009 catch rates increased rapidly, however, catch rates have since dropped back to levels closer to the long term average in the fishery (Morison et al. 2012).
In Australia, the speciesis most abundant in Bass Strait and during the egg-laying period enters large estuaries and bays, such as American River, Kangaroo Island and parts of the west coast in South Australia, and Westernport Bay, Port Phillip Bay and Barwon River estuary in Victoria. In New Zealand it is most abundant on the east coast of the South Island.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats

In southern Australia,Elephant Fish have been retained by fishers as byproduct to the targeting ofSchool Shark (Galeorhinus galeus)andGummy Shark (Mustelus antarcticus)in continental shelf waters since the mid-1920s and possibly earlier in inshore areas. Baited hooks attached to bottom-set longlines was the principal fishing method until the early 1970s when the method was replaced by bottom-set gillnets. Elephant Fish are captured with gillnets of 66" mesh-size off Victoria and Tasmania, but only small quantities are caught off Western Australia and South Australia. Since 1970, the catch ofElephant Fish from the Shark Gillnet Sector varied 4118 tonnes (carcass mass) (Walker and Gason2009). Some targeting of females occurs inshore by recreational fishers during the egg-laying period.For fishing methods other than shark gillnetting in the Southern and Eastern Scalefish and Shark Fishery, mean annual catch during the 7-year period 200006 estimated by combining monitoring data from scientific on-board observers and mandatory catch and effort returns submitted by commercial fishing operators was 48 t whole mass of which 94% was retained for marketing and 6% discarded. Most of this catch was taken off southern New South Wales and eastern Victoria by demersal otter trawl (12%) and Danish seine (85%), and in the Great Australian Bight (3%) (Walker and Gason 2007). The recreational catch mass by recreational fishers in Westernport Bay of Victoria was estimated at 45 t, carcass mass, during 2008 (Braccini et al. 2009).


In New Zealand, the species is most abundant off the east coast of the South Island. The fishery appears to be stable with populations likely to be above the biomass required to provide the maximum sustainable yield (Annalaet al.2002, Coakley 1971, 1973, Gorman 1963, McClatchie and Lester 1994).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

In southern Australia, management measures in the Southern and Eastern Scalefish and Shark Fishery include limited entry for the use of gillnets and longlines (since 1984) and Total Allowable Catches (TAC) (since 2002) initially of 40 t carcass mass ofElephant Fishfor the Shark Gillnet and Shark Hook Sectors, 15 t for the South East Trawl Sector, and 28 t for other sectors and a component for discards. An overall TAC of 109 t across all sectors applied in 201314 (Marton and Curtotti 2014). Input controls include limits on length of net (since 1988), various 4 to 6 week closed seasons to protect pregnant females ofSchool Sharkduring October to December (195367 and 199394), and a legal minimum mesh-size of 6 inches for gillnets (since 1975) for most of the fished area. A 3 nautical mile closure of all Victorian waters since 1988 to shark gillnet fishing provides a large refuge for the Elephant Fish(Walker 1999).

Several recent management measures in southern Australia benefit the conservation ofElephant Fish.

  • Restructuring of the Southern and Eastern Scalefish and Shark Fishery during 200607 through buy-back of Commonwealth fishing licences (Penney et al. 2014) and progressive reductions in Total Allowable Catches (TACs) markedly reduced overall fishing effort, particularly in southern New South Wales (Walker and Gason 2007).
  • Implementation of the Management Plan (operational since 1 July 2013) for the South-East Commonwealth Marine Reserves Network (proclaimed in 2007) prohibits demersal otter trawl and Danish seining, and in some areas all other fishing methods, in 14 Commonwealth marine reserves (including one at Macquarie Island) covering ~388,464 km2 over a diverse range of temperate marine environments on the continental shelf, continental slope, and abyssal plain. Stretching from the far south coast of New South Wales, around Tasmania and Victoria, and west to Kangaroo Island off South Australia, the network provides several refuges over the entire depth range of theElephant Fish(Anonymous 2013).The Management Plan for the South-West Commonwealth Marine Reserves Network (not yet implemented) is expected to provide further refuges forElephant Fish.

In New Zealand, TACs have been in place since 1986 and the catch per unit effort trend increased during 1989 to 2001. As a result, the TAC increased from 619 to 1,040 tonnes over this time period (Annalaet al.2002).

There are recreational bag limits of 20 fish per day in New Zealand and 1 fish per day in Victoria.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Australian ghostshark

The Australian ghostshark, Callorhinchus milii, is a cartilaginous fish (Chondrichthyes) belonging to the subclass Holocephali (chimaera). Sharks, rays and skates are the other members of the cartilaginous fish group and are grouped under the subclass Elasmobranchii. Alternative names include elephant shark, makorepe (in Māori), whitefish, plownose chimaera, or elephant fish. It is found off southern Australia, including Tasmania, and south of East Cape and Kaipara Harbour in New Zealand, at depths of 0 – 200 m.

Morphology and biology[edit]

The fish is silvery in colour with iridescent reflections and dark, variable markings on the sides.[1] Males mature at 50 cm and females at 70 cm, and the maximum length head to tail is 1.5 m[1] It has an elongated body and two widely separated, triangular dorsal fins. They use their hoe-shaped snouts to probe the ocean bottom for invertebrates and small fishes.[1]

From spring to autumn, adults migrate inshore to estuaries and bays and females lay their eggs on sandy or muddy substrates. The eggs are contained in large yellowish capsules. The egg partially opens enabling seawater to flow in to the egg capsules after a few months and juveniles emerge from the capsule after six to eight months as about 12 cm in length. Maximum age is estimated to be 15 years.[1]

This fish has three cone pigments for colour vision (like humans); its dorsal fin has a very sharp spine. The spine has been reputed to be venomous, but no serious injuries have yet been reported.[2]

Fishing[edit]

In New Zealand, Australian ghostsharks are exploited commercially, particularly during spring and summer when they migrate into shallow coastal waters.

In Australia, they are caught by southern shark gillnet fishery, particularly in Bass Strait and south-east Tasmania, though this fishery targets the gummy shark, Mustelus antarcticus, and will sometimes discard ghostsharks due to the considerably lower price they fetch at market. They are also a popular target of recreational fishers in Westernport Bay, Victoria and in the inshore waters of south-east Tasmania. Their white flesh fillets are very popular with fish-and-chips restaurants in New Zealand and is sold as 'flake' or 'whitefish' in Australia.

Genome study[edit]

In January 2014, Nature reported research into the Australian ghostshark genome[3] that showed they lack a single gene family that regulates the process of turning cartilage into bone, and indicates a gene duplication event gave rise to the transformation in bony vertebrates.[4]

The Australian ghostshark was proposed as a model cartilaginous fish genome because of its relatively small genome size. Its genome is estimated to be 910 megabases long, which is the smallest among all the cartilaginous fishes and one-third the size of the human genome (3000 Mb). Because cartilaginous fishes are the oldest living group of jawed vertebrates, the Australian ghostshark genome will serve as a useful reference genome for understanding the origin and evolution of vertebrate genomes including humans, which shared a common ancestor with the Australian ghostshark about 450 million years ago. Interestingly, studies so far have shown the sequence and the gene order (synteny) are more similar between human and elephant shark genomes than between human and teleost fish genomes (pufferfish and zebrafish), though humans are more closely related to teleost fishes than to the Australian ghostshark. The Elephant Shark Genome Project was launched with the aim to sequence the whole genome of the elephant shark.

References[edit]

  1. ^ a b c d Bray, Dianne. "Elephantfish, Callorhinchus milii". Fishes of Australia. Retrieved 11 September 2014. 
  2. ^ "Boy hospitalised by fish spike". The New Zealand Herald. 13 April 2012. Retrieved April 13, 2012. 
  3. ^ Author: Byrappa Venkatesh, a comparative-genomics expert at the Agency for Science, Technology and Research, Singapore
  4. ^ Why sharks have no bones: (Callorhinchus milii) Elephant shark's genome - the first of a cartilaginous fish - exposes early evolution of vertebrates., Brendan Borrell, Nature, 8 January 2014, accessed 9 January 2014
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!