Overview

Comprehensive Description

Biology

Occurs on continental shelves to depths of at least 200 m (Ref. 6871). Migrates into large estuaries and inshore bays in the spring to breed (Ref. 6871). Feeds mainly on shellfish (Ref. 26346). Oviparous (Ref. 50449). Eggs are encased in horny shells (Ref. 205). Flesh is of good eating quality. Males have a small, club-like protuberance on the head and also long copulation organs near the pelvic fins (Ref. 557).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

The assessment assumes a single genetic stock in southern Australia and a separate single genetic stock in New Zealand.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Southwest Pacific: southern Australia and New Zealand.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Southern Australia and New Zealand.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 1250 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

125 cm TL (male/unsexed; (Ref. 26346))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
C. milii is oviparous laying leathery egg cases in pairs in shallow water that may take up to 10 months to hatch (Last and Stevens 1994, Smith 2001). It is a seasonal breeder with females moving to shallower habitats to lay eggs (Francis 1997, Last and Stevens 1994, Reardon 2001, Smith 2000). Eggs are laid over several weeks each year. Juveniles remain in the shallow habitats for up to three years, which may make them vulnerable to trawl capture in New Zealand (Francis 1997). C. milii appears to be sexually segregated as males and females are often caught separately by commercial fishermen (T. I. Walker, unpublished data). C. milii has relatively high biological productivity. Maturity occurs relatively early at 70 cm fork length (FL) for females, and 50 cm FL for males. Maximum age has been estimated as nine years from ageing using growth increments in dorsal fin spines (T. I. Walker, unpublished data) and 15 years from a tag return (Francis 1997, Annala et al. 2002).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; oceanodromous (Ref. 51243); marine; depth range 0 - 227 m (Ref. 26346)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1053 specimens in 1 taxon.
Water temperature and chemistry ranges based on 322 samples.

Environmental ranges
  Depth range (m): 7 - 151
  Temperature range (°C): 7.950 - 17.654
  Nitrate (umol/L): 0.293 - 17.077
  Salinity (PPS): 34.377 - 36.031
  Oxygen (ml/l): 5.146 - 6.351
  Phosphate (umol/l): 0.166 - 1.158
  Silicate (umol/l): 0.677 - 4.926

Graphical representation

Depth range (m): 7 - 151

Temperature range (°C): 7.950 - 17.654

Nitrate (umol/L): 0.293 - 17.077

Salinity (PPS): 34.377 - 36.031

Oxygen (ml/l): 5.146 - 6.351

Phosphate (umol/l): 0.166 - 1.158

Silicate (umol/l): 0.677 - 4.926
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 227m.
Recorded at 227 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs on continental shelves to depths of at least 200 m. Migrates into large estuaries and inshore bays in the spring to breed (Ref. 6871). Feeds mainly on shellfish (Ref. 26346).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Migrates into large estuaries and inshore bays in the spring to breed (Ref. 6871). Oviparous, two egg cases (Ref. 26346) are laid on sandy or muddy bottoms and take up to 8 months to hatch (Ref. 6871). Embryos feed solely on yolk (Ref. 50449).Young hatch at about 15 cm (Ref. 26346).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 6 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Callorhinchus milii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATTTACTTTTTGGTGCCTGGGCAGGAATAGTTGGTACTGCCCTTAGCCTATTAATTCGAGCTGAACTAAGTCAGCCTGGAGCATTAATAGGTGATGACCAAATCTATAATGTTATTGTTACTGCACATGCCTTTGTAATAATTTTCTTTATAGTTATACCCATTATAATCGGAGGTTTTGGAAACTGATTAATCCCTTTAATAATTGGTGCACCTGATATAGCTTTCCCACGAATAAATAATATAAGTTTCTGATTATTACCTCCTTCCTTTCTTCTTCTTTTAGCCTCTGCAGGAGTTGAAGCTGGAGCAGGAACAGGTTGAACTGTCTATCCACCACTAGCTGGTAACCTTGCACATGCCGGAGCATCCGTAGATTTAACTATCTTCTCCTTACATTTAGCAGGTATCTCATCTATCTTAGCTTCTATTAATTTTATTACAACAATTATTAACATAAAACCCCCATCTATCACGCAATATCAAACACCTTTATTTGTATGATCAATCCTTATTACTACAATTCTTCTCCTACTTTCCCTACCTGTCCTAGCTGCAGGTATCACTATACTACTTACTGATCGTAATCTTAATACAACATTCTTTGATCCGGCTGGAGGAGGAGATCCTATTTTATACCAACACTTANNN
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Callorhinchus milii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 18
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2003

Assessor/s
Reardon, M., Walker, T.I. & Francis, M.P. (SSG Australia & Oceania Regional Workshop, March 2003)

Reviewer/s
Kyne, P.M. & Cavanagh, R.D. (Shark Red List Authority)

Contributor/s

Justification
The holocephalan Callorhinchus milii is relatively abundant and is caught as byproduct in fisheries of Southern Australia and New Zealand. In southern Australia, commercial catch rates have been stable for the past 20 years, while fishing effort is reducing and a Total Allowable Catch (TAC) was implemented during 2002. On-board monitoring over the past 25-year period indicates the change in the number of animals caught per unit of fishing effort was not statistically significant. A three-mile closure of all Victorian waters to shark fishing provides a large refuge for the species in southern Australia. In New Zealand TACs have been in place since 1986 and the CPUE trend increased during 1989 to 2001. As a result, the total TAC increased from 619 to 1,040 tonnes over this time period. The species is most abundant off the east coast of the South Island. This fishery appears to be stable with populations likely to be above the biomass required to provide the maximum sustainable yield. The species has relatively high biological productivity; maximum age of 15 years, matures relatively early and continues to lay eggs over several weeks each year. No contraction of range or fragmentation of the population has occurred.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
In southern Australia, C. milii is most abundant in Bass Strait and during the egg-laying period enters large estuaries and bays (e.g., American River Kangaroo Island and parts of the West Coast in South Australia, and Port Phillip Bay and Western Port Bay in Victoria) (Last and Stevens 1994). In New Zealand it is most abundant on the east coast of the South Island. No contraction of range or fragmentation of the population has occurred.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
C. milii is caught both commercially and recreationally in southern Australia and New Zealand. The sports fishery in New Zealand is currently recovering. The flesh is of good quality and is sold in seafood markets as whitefish fillets (Last and Stevens 1994).

C. milii is captured as byproduct from targeting M. antarcticus with gillnets of 6?6½" mesh-size off South Australia, Victoria and Tasmania. During 1970?2001 the catch of C. milii from the Southern Shark Fishery varied 4?118 tonnes (carcass weight), 2% of the total catch of all shark species (Walker et al. 2002). There is some targeting of females inshore by recreational fishers during the egg-laying period.

Small quantities are taken as byproduct in the South East Trawl Fishery, which targets a range of quota teleost species with demersal trawl nets off New South Wales, eastern Victoria and eastern Tasmania. The catch from this sector was 22 tonnes during 2002.

In southern Australia, commercial catch rates have been stable for the past 20 years, while fishing effort is reducing (Walker et al. 2002). On-board monitoring over the past 25-year period indicates the number of animals caught per unit of fishing effort declined to 67%; the change is not statistically significant (Walker et al. in press).

In New Zealand, the species is most abundant off the east coast of the South Island. The fishery appears to be stable with populations likely to be above the biomass required to provide the maximum sustainable yield (Annala et al. 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Australia and New Zealand both have TAC limits in place for the elephant fish. In New Zealand, there is a recreation bag limit of 20 fish per day. Part of its range incorporates areas closed to shark fishing and marine protected areas. A three-mile closure of all Victorian waters to shark fishing provides a large refuge for the species in southern Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Australian ghostshark

The Australian ghostshark, Callorhinchus milii, is a cartilaginous fish (Chondrichthyes) belonging to the subclass Holocephali (chimaera). Sharks, rays and skates are the other members of the cartilaginous fish group and are grouped under the subclass Elasmobranchii. Alternative names include elephant shark, makorepe, whitefish, plownose chimaera, or elephant fish.

It is found off southern Australia, including Tasmania, and south of East Cape and Kaipara Harbour in New Zealand, at depths of 0 - 200 m. Their length is up to 120 cm. Males of this species mature at about 65 cm. From spring to autumn, adults migrate inshore to estuaries and bays and females lay their eggs on sandy or muddy substrates. The eggs are contained in large yellowish capsules. The egg partially opens enabling seawater to flow in to the egg capsules after a few months and juveniles emerge from the capsule after six to eight months as about 12 cm in length. In New Zealand, Australian ghostsharks are exploited commercially, particularly during spring and summer when they migrate into shallow coastal waters. In Australia, they are caught by southern shark gillnet fishery, particularly in Bass Strait and south-east Tasmania, though this fishery targets the gummy shark, Mustelus antarcticus, and will sometimes discard ghostsharks due to the considerably lower price they fetch at market. They are also a popular target of recreational fishers in Westernport Bay, Victoria and in the inshore waters of south-east Tasmania. Their white flesh fillets are very popular with ‘fish-and-chips’ restaurants in New Zealand, but less so in Australia.

This fish has three cone pigments for colour vision (like humans); its dorsal fin has a very sharp spine. The spine has been reputed to be venomous, but no serious injuries have yet been reported.[1]

Genome study[edit]

In January 2014, Nature reported research into the elephant shark (Callorhinchus milii) genome [2] that showed these chimaeras lack a single gene family that regulates the process of turning cartilage into bone, and indicates a gene duplication event gave rise to the transformation in bony vertebrates. .[3]

The Australian ghostshark was proposed as a model cartilaginous fish genome because of its relatively small genome size. Its genome is estimated to be 910 megabases long, which is the smallest among all the cartilaginous fishes and one-third the size of the human genome (3000 Mb). Because cartilaginous fishes are the oldest living group of jawed vertebrates, the Australian ghostshark genome will serve as a useful reference genome for understanding the origin and evolution of vertebrate genomes including humans, which shared a common ancestor with the Australian ghostshark about 450 million years ago. Interestingly, studies so far have shown the sequence and the gene order ("synteny") are more similar between human and elephant shark genomes than between human and teleost fish genomes (pufferfish and zebrafish), though humans are more closely related to teleost fishes than to the Australian ghostshark. The Elephant Shark Genome Project was been launched with the aim to sequence the whole genome of the elephant shark.

References[edit]

  1. ^ "Boy hospitalised by fish spike". The New Zealand Herald. 13 April 2012. Retrieved April 13, 2012. 
  2. ^ (Author: Byrappa Venkatesh, a comparative-genomics expert at the Agency for Science, Technology and Research, Singapore),
  3. ^ Why sharks have no bones: (Callorhinchus milii) Elephant shark's genome - the first of a cartilaginous fish - exposes early evolution of vertebrates., Brendan Borrell, Nature, 8 January 2014, accessed 9 January 2014
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!