Overview

Brief Summary

Biology

Blue-spotted stingrays live alone or in small groups (6), migrating in large schools into shallow sandy areas on the rising tide in order to feed, and dispersing back into the ocean as the tide falls to shelter in the coral crevices of the reef (5) (7). Feeding most commonly occurs during the day, but sometimes also at night (6), and the diet consists largely of worms, shrimps, crabs, molluscs and small fish (5). Prey is often detected through electroreception, a system which senses the electrical fields produced by the prey (5). Not all small fish and invertebrates are potential prey, as blue-spotted stingrays can often be found at 'cleaning stations', areas of reef where large fish line up and tiny fish or shrimp pick off their dead skin and parasites (6). In courtship, males often follow females, using their acutely sensitive 'nose' to detect a chemical signal emitted by the female that indicates she is receptive. Breeding occurs from late spring through the summer, and gestation can last anything from four months to a year (5). Reproduction is ovoviviparous, meaning females give birth to live pups that have hatched from egg cases inside the uterus (6). Up to seven pups are born per litter and each juvenile is born with the distinctive blue markings of its parents in miniature (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

WhyReef - Lifestyle

You can usually find the blue-spotted stingray in the shallow, sandy, or rocky areas on a reef, but unlike its other stingray cousins, it doesn’t bury itself in the sand. It is important for it to stay clean so everyone can see its bright blue spots. These spots are a warning to everyone to stay away because it is venomous.

Like cars, the blue-spotted stingray needs regular cleaning sessions, so it visits cleaning stations on the reef. These are places where small fish and shrimp come to pick bacteria and dead skin off its body. At the cleaning station, everyone wins: the stingray stays clean and the fish and shrimp get to eat the grime off its body. Scientists call this a mutualistic relationship.

Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

This colourful stingray is immediately recognisable by the large, bright, iridescent blue spots that adorn its oval, elongated body (3) (4). Distinctive blue stripes also run along either side of the tail, which is equipped with one or two sharp venomous spines at the tip, used by the ray to fend off predators (5). Indeed, the brightly-coloured skin acts as 'warning colouration' to alert other animals that it is venomous (6). The snout is rounded and the mouth is found on the underside of the body, along with the gills (5), perfect for scooping up animals hiding in the sand (6). Two plates exist within the mouth that are adapted for crushing the shells of crabs, prawns and molluscs (5). The upper surface of the body disc is grey-brown to yellow, olive-green or reddish brown, while the underside is white (3). Thus, when viewed from below the white belly blends in with the sunny waters above and when viewed from above, the dark, mottled back blends in with the dark ocean floor below (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Occurs around coral reefs (Ref. 6871, 58534). Migrates in groups into shallow sandy areas during the rising tide to feed on mollusks, worms, shrimps, and crabs; disperses on falling tide to seek shelter in caves and under ledges (Ref. 6871). Rarely found buried under the sand (Ref. 12951). Ovoviviparous (Ref. 50449). Small specimens are popular among marine aquarists (Ref. 5578). Does not do well in aquariums (Ref. 12951). Maximum length about 70 cm TL (Ref. 30573). Reports of specimens reaching 240 cm TL are probably inaccurate (Ref. 6871). Commonly caught by fisheries operating over shallow coral reefs and probably adversely affected by dynamite fishing. Utilized widely for its meat (Ref.58048).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

WhyReef - Fun Facts

The blue-spotted stingray sports two sharp spines on the tip of its venomous tail. By flipping its tail, it can attack its enemies and inject them with deadly venom. As if this weren’t enough, it hunts its prey using electroreception, sensing the electric fields given off by other animals. To catch its prey, it pins them to the reef bottom and then crushes them with the tooth plates in its mouth.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-West Pacific: Red Sea and East Africa to the Solomon Islands, north to southern Japan (Ref. 9710), south to northern Australia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Widespread in the Indo-West Pacific, including South Africa, Mozambique, Madagascar, Mauritius, Seychelles, Tanzania (Zanzibar), Kenya, Red Sea (Lohaja and Massaua), Saudi Arabia, Gulf of Aden, Gulf of Oman, Persian Gulf, Pakistan, India, Sri Lanka, Myanmar, Malaysia, Singapore, Indonesia, Thailand, Vietnam, the Philippines, Papua New Guinea, the Solomons, Australia, Melanesia and Polynesia (Fowler 1941, Herre 1953, Last and Stevens 1994, Last and Compagno 1999).
No information exists on subpopulations.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Taeniura lymma, commonly known as blue-spotted stingrays, is found primarily in the Indo-west Pacific. They may be found in shallow continental shelf waters ranging from temperate to tropical seas. They prefer areas with sandy or sedimentary substrates in which they bury themselves. Sightings of Taeniura lymma have been recorded in Australia in shallow tropical marine waters from Ningaloo Reef, Western Australia to Bundaberg, Queensland. They can be found at depths of up to 25 m and have also been recorded to range in location from southern Africa and the Red Sea to the Solomon Islands.

Biogeographic Regions: australian (Native ); indian ocean (Native ); pacific ocean (Native )

  • Taylor, M. 1997. Sharks & Rays. Sydney, AU: Time-Life Books.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Djibouti, East Africa, Eritrea, Kenya, Madagascar, Mozambique, Red Sea, Seychelles, Somalia, South Africa (country), Tanzania
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red Sea, Indo-West Pacific: East and South Africa east to Philippines and Fiji, north to southern Japan, south to Shark Bay (Western Australia), New South Wales (Australia) and New Caledonia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Found in the Indo-West Pacific: ranging from South East Africa and the Red sea to the Solomon Islands, north to southern Japan and south to northern Australia (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Taeniura lymma is a colorful stingray with distinct, large, bright blue spots on its oval, elongated body. The snout is rounded and angular with broad outer corners. The tail tapers and can be equal to or slightly less than the body length when intact. Its caudal fin is broad and reaches to the tip of the tail. At the tip of the tail are two sharp venomous spines which permit this ray to strike at enemies forward of its head. The tail of Taeniura lymma can be easily recognized by the blue side-stripes found on either side. It has large spiracles that lie very close to its large eyes. It can grow to a disc diameter of about 25 cm but has been reported as being as large as 95 cm in diameter. The mouth is found on the underside of the body along with the gills. Within the mouth are two plates, which are used for crushing the shells of crabs, prawns, and mollusks.

Range length: 95 (high) cm.

Average length: 25 cm.

Other Physical Features: ectothermic ; bilateral symmetry ; venomous

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 300 mm WD
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

35.0 cm WD (male/unsexed; (Ref. 58048))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

A colorful stingray with large bright blue spots on an oval, elongated disc and with blue side-stripes along the tail; snout rounded and angular, disc with broadly rounded outer corners, and tail stout, tapering and less than twice body length when intact, with a broad lower caudal finfold reaching the tail tip; disc with no large thorns but with small, flat denticles along midback (in adults); usually 1 medium-sized sting on tail further behind base than in most stingrays (Ref. 5578). Grey-brown to yellow, olive-green or reddish brown dorsally, white ventrally (Ref. 5578).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Found inshore, at depths less than 20 m (Ref. 9840). Migrates in groups into shallow sandy areas during the rising tide to feed on molluscs, worms, shrimps, and crabs; disperses on falling tide to seek shelter in caves and under ledges (Ref. 6871). Disk width about 95 cm. Reports of specimens reaching 240 cm TL are probably inaccurate (Ref. 6871). Taken mainly by traditional fishermen (Ref. 9840).
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range ? - 20 m (Ref. 9840)
  • Last, P.R. and L.J.V. Compagno 1999 Dasyatididae. Stingrays. p. 1479-1505. In K.E. Carpenter and V.H. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 3. Batoid fishes, chimaeras and bony fishes part 1 (Elopidae to Linophrynidae). FAO, Rome. (Ref. 9840)   http://www.fishbase.org/references/FBRefSummary.php?id=9840&speccode=15387 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
A small stingray characteristic of coral reef habitats. Also found foraging near seagrass patches (Yahya and Jiddawi pers. comm.). Moves with rising tide into shallow, sandy areas to feed on molluscs, and shelters in caves and under ledges when the tide falls (Last and Stevens 1994).

Despite its relative abundance in some areas, almost no information is available on its life history parameters (age at maturity, longevity, average reproductive age, generation time and annual fecundity are all unknown).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Taeniura lymma is found on sandy bottoms around coral reefs. These rays like to bury themselves just underneath the sand where they will feed on various invertebrates. They usually are found on shallow continental shelves; however, they have also been observed around coral rubble and shipwreck debris at depths of 20-25m deep. Divers and snokelers will often detect this ray by its distinctive ribbon-like tail poking out from a crack in the coral. These rays are most abundant inshore.

Range depth: 25 (high) m.

Habitat Regions: tropical ; saltwater or marine

Aquatic Biomes: benthic ; reef

  • Allen, T. 1996. Shadows In The Sea. New York, NY: Lyons & Burford, Publishers.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 7 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 2 - 30
  Temperature range (°C): 27.121 - 28.876
  Nitrate (umol/L): 0.037 - 0.617
  Salinity (PPS): 33.821 - 34.915
  Oxygen (ml/l): 4.450 - 4.700
  Phosphate (umol/l): 0.129 - 0.185
  Silicate (umol/l): 1.214 - 3.618

Graphical representation

Depth range (m): 2 - 30

Temperature range (°C): 27.121 - 28.876

Nitrate (umol/L): 0.037 - 0.617

Salinity (PPS): 33.821 - 34.915

Oxygen (ml/l): 4.450 - 4.700

Phosphate (umol/l): 0.129 - 0.185

Silicate (umol/l): 1.214 - 3.618
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 20m.
Recorded at 20 meters.

Habitat: reef-associated. Bluespotted ribbontail ray.   (Forsskal, 1775)  Attains a length of 2.4m and a width of 95 cm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Commonly found on the sandy or rocky bottoms of coral reefs, in shallow continental shelf waters, to depths of 20 m (3) (5). While usually inhabiting the deeper reef areas, where it hides in reef caves, under tabletop corals and overhangs, this stingray moves up to shallower reef flats and lagoons at high tide. Unlike most stingrays, blue-spotted stingrays rarely bury themselves in the sand (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Found on the continental shelf (Ref. 75154). Feeds on fish and invertebrates (Ref. 5578).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Taeniura lymma has very distinct feeding behaviors. During high tide, it migrates in groups into shallow sandy areas of tidal flats to feed on sand worms, shrimps, hermit crabs, and small fishes. At low tide it recedes back into the ocean, usually alone to hide in the coral crevices of the reef.

Blue-spotted stingrays will feed on many things such as bony fish, crabs, shrimp, polychaetes and other benthic invertebrates. Since the mouth is located on the underside of the body, food is trapped by pressing the prey into the substrate with their discs. The food is then directed into the mouth by maneuvering the disc over the prey.

Taeniura lymma can detect its prey through an electroreceptor system. The nostrils are partly covered with a broad fleshy lobe, known as the internasal flap. This is covered in sensory pores and extends to the mouth. These pores form part of the ampullae of Lorenzini (the electrorecption system.) This electroreceptor system can detect electrical fields produced by the prey. This electroreceptor system cannot only be used to detect prey but can also be used to detect predators and other members of the same species.

Animal Foods: fish; aquatic or marine worms; aquatic crustaceans; other marine invertebrates

Primary Diet: carnivore (Piscivore , Eats non-insect arthropods)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Taeniura lymma plays an important role in their ecosystem. Taeniura lymma is a secondary consumer. It feeds on nekton such as bony fish. It also feeds on zoobenthos organisms including benthic crustaceans like crabs, shrimp/prawns, and worms such as polychaetes.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

The most dangerous predator to blue-spotted stingrays are human beings. Blue-spotted stingrays are a popular ray to have in aquarium tanks. However, Taeniura lymma is very hard to take care of in an at-home aquarium. Besides humans, the only other type of predator known to this species of stingrays is the hammerhead shark. The hammerhead shark uses the cartilaginous projections form the side of their heads to pin them down to the bottom of the substrate while taking bites from the stingray's disc. The hammerhead is able to avoid being stung by the poisonous spines on the rays tail by pinning the stingray down.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

WhyReef - Menu

The blue-spotted stingray eats shrimps, crabs, snails (and other mollusks), and small fish. Since it only eats animals it is a carnivore.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Taeniura lymma uses electroreception to communicate with other members of its species. Blue-spotted stingrays,use strucutres called the ampullae of Lorenzini, which allow them to detect slight electrical impulses within the water. This electroreception is often used as a means of recognizing members of the same species.

Communication Channels: chemical ; electric

Perception Channels: visual ; tactile ; chemical ; electric

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Exhibit ovoviparity (aplacental viviparity), with embryos feeding initially on yolk, then receiving additional nourishment from the mother by indirect absorption of uterine fluid enriched with mucus, fat or protein through specialised structures (Ref. 50449). Distinct pairing with embrace (Ref. 205). Distinct pairing with embrace (Ref. 205). Bears up to 7 young (Ref. 5578, 12951).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Development

When blue-spotted stingrays are born, they hatch out of egg cases and are pale gray or brown and are spotted with black or rusty red and white. These patterns and markings are distinct to each individual within a litter. As adults, they are olive-gray or gray-brown to yellow dorsally and white ventrally with numerous blue spots. When born, the young stingrays are about nine cm long and can grow to around 25cm as adults. The young are born out of egg cases with a soft tail that is encases in a thin layer of skin to prevent injury to the mother during birth. The skin is eventually lost and the tail is used as a protective mechanism.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The lifespan of Taeniura lymma is still unknown.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Taeniura lymma is ovoviviparous. This means that the embryo is nourished by the yolk and the eggs are retained within the female until they hatch. The ray produces about seven live young in every litter. Each juvenile is born with the distinctive blue markings of its parents in miniature. In courtship, the male often follows the female with his acutely sensitive nose close to her cloaca in search of a chemical signal that the female will emit. Courtship usually includes some sort of nibbling or biting of the disc. The teeth of the male are used to hold the female in place during population. The male fertilizes the female via internal fertilization through the use of their claspers. The breeding season is usually in late spring through the summer and gestation can be anywhere from 4 months to a year.

Because only about seven live young are produced in each litter, this species is highly vulnerable to population collapses from overfishing, habitat loss and the pet trade. They also have a long gestation period making them even more susceptible to population collapse.

Breeding season: late spring throught summer

Average number of offspring: 7.

Range gestation period: 4 to 12 months.

Key Reproductive Features: iteroparous ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); ovoviviparous

  • Taylor, M. 1997. Sharks & Rays. Sydney, AU: Time-Life Books.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Taeniura lymma

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATTTAGTATNTGGTGCATGAGCAGGGATAGTGGGTACCGGCCTAAGCCTGCTAATCCGTACAGAACTAAGCCAACCAGGCGCTCTATTGGGTGATGATCAAATCTACAACGTAATTGTCACCGCCCATGCCTTTGTAATAATTTTCTTCATAGTTATACCAATTATAATTGGTGGATTTGGTAACTGACTAGTTCCTCTAATAATTGGAGCTCCAGACATGGCCTTCCCACGAATAAATAATATAAGCTTCTGACTTCTTCCCCCCTCCTTTCTACTACTACTAGCCTCAGCAGGAGTAGAAGCTGGAGCCGGTACAGGCTGAACAGTTTATCCCCCATTAGCCGGTAATCTAGCACATGCAGGAGCCTCCGTAGACCTTACAATCTTCTCCCTACACCTAGCAGGTGTCTCCTCCATCTTAGCATCTATCAACTTTATCACGACAATTATTAATATAAAACCACCTGCAATCTCCCAATATCAAACCCCCTTGTTTGTCTGATCTATTCTTATTACAACCGTACTTCTCTTATTATCCCTTCCAGTTCTAGCAGCTGGCATTACCATGCTTCTTACAGATCGAAATCTTAATACAACTTTCTTCGATCCAGCCGGAGGAGGAGATCCAATCCTCTATCAACATCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Taeniura lymma

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 29
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 3 specimens with morphological vouchers housed at Ocean Genome Legacy
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2005

Assessor/s
Compagno, L.J.V.

Reviewer/s
Musick, J.A. & Fowler, S.L. (Shark Red List Authority)

Contributor/s

Justification
This assessment is based on the information published in the 2005 shark status survey (Fowler et al. 2005).

Although very wide ranging and common, the Ribbontailed Stingray (Taeniura lymma) is subject to human-induced problems because of heavy inshore fisheries in most places where it occurs, its attractiveness for the marine aquarium fish trade (small size and brilliant colour pattern) and, especially, by widespread destruction of its reef habitat.

History
  • 2000
    Lower Risk/near threatened
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Although this species is very wide ranging and common, it is subject to human-induced problems because of capture by inshore fisheries and its attractiveness for the marine aquarium fish trade. Another major threat to this species is the destruction of its coral reef habitat. Without a habitat in which to live, this species may be pushed to extinction along with other species of the coral reef habitat.

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: near threatened

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Lower Risk/near threatened (LR/nt) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Near Threatened (NT)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
This ray is commonly taken where heavy artisanal and small-scale commercial fisheries occur in or around coral reef habitats. Additionally, it may possibly be exploited locally for capture for the marine aquarium trade. It is at risk in many areas because of its dependence on coral reef habitats. These are under massive assault from net, dynamite and cyanide fisheries for teleosts in many places where the species occurs. In East Africa, artisanal fishers catch T. lymna using bottom¬set gillnets, longlines and skin-diving with spears, and also as bycatch in fence traps (S. Yahya and N. Jiddawi pers. obs.). Habitat loss and degradation therefore likely exert a significant impact on populations.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

WhyReef - Threats

People hunt blue-spotted stingrays to sell to aquariums, but they don’t make good aquarium animals because they grow too large.

Reefs are in danger, and that means so is the home of the blue-spotted stingray!

Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Despite being both wide-ranging and common, the blue-spotted stingray is subject to a variety of human-imposed threats (1). Widespread destruction of coral reef habitat probably poses the most significant threat to the species (1). Harm is caused by poisoning through farm pesticides and fertilizers running into the sea, by dynamite fishing, and by cyanide, used to capture reef animals for the pet trade (6). This ray is hunted throughout its range by inshore fisheries and its beautiful colouration makes it an attractive candidate for an aquarium pet (5) (6). However, this species does not survive well as a pet, outgrowing most home aquariums (6). With such a low reproductive rate, consisting of long gestation periods and small litters, the blue-spotted stingray is particularly vulnerable to population collapses caused by over-fishing, habitat loss and the pet trade (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
No conservation or management initiatives have been identified.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Presently, this stingray is classified only as Lower Risk/near threatened (LR/nt) on the IUCN Red List 2004, and no direct conservation measures are currently in place for the species (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; gamefish: yes; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

The sting that of blue-spotted stingrays may be very painful.

Negative Impacts: injures humans (bites or stings)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Taeniura lymma is a popular aquarium pet. Their beautiful coloration makes them a prime candidate for an aquarium pet. In Australia, Taeniura lymma is often eaten and hunted for its meat.

Positive Impacts: pet trade

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Bluespotted ribbontail ray

Not to be confused with the bluespotted stingray, Neotrygon kuhlii.

The bluespotted ribbontail ray (Taeniura lymma) is a species of stingray in the family Dasyatidae. Found from the intertidal zone to a depth of 30 m (100 ft), this species is common throughout the tropical Indian and western Pacific Oceans in nearshore, coral reef-associated habitats. It is a fairly small ray, not exceeding 35 cm (14 in) in width, with a mostly smooth, oval pectoral fin disc, large protruding eyes, and a relatively short and thick tail with a deep fin fold underneath. It can be easily identified by its striking color pattern of many electric blue spots on a yellowish background, with a pair of blue stripes on the tail.

At night, small groups of bluespotted ribbontail rays follow the rising tide onto sandy flats to root for small benthic invertebrates and bony fishes in the sediment. When the tide recedes, the rays separate and withdraw to shelters on the reef. Reproduction is aplacental viviparous, with females giving birth to litters of up to seven young. This ray is capable of injuring humans with its venomous tail spines, though it prefers to flee if threatened. Because of its beauty and size, the bluespotted ribbontail ray is popular with private aquarists despite being poorly suited to captivity. The International Union for Conservation of Nature (IUCN) has listed this species as Near Threatened, as it faces widespread habitat degradation and intensive fishing pressure throughout its range.

Contents

Taxonomy and phylogeny

Photo of the front part of a stingray from the side, showing large protruding eyes and bright blue spots
A bluespotted ribbontail ray in Komodo National Park, Indonesia.

The bluespotted ribbontail ray was originally described as Raja lymma by Swedish naturalist Peter Forsskål, in his 1775 Descriptiones Animalium quae in itinere ad maris australis terras per annos 1772, 1773, et 1774 suscepto collegit, observavit, et delineavit Joannes Reinlioldus Forster, etc., curante Henrico Lichtenstein.[2] The specific epithet lymma means "dirt".[3] Forsskål did not designate a type specimen.[2] In 1837, German biologists Johannes Peter Müller and Friedrich Gustav Jakob Henle created the genus Taeniura for Trygon ornatus, now known to be a junior synonym of this species.[4][5]

Other common names used for this species include bluespotted ray, bluespotted fantail ray, bluespotted lagoon ray, bluespotted stingray, fantail ray, lesser fantail ray, lagoon ray, reef ray, ribbon-tailed stingray, and ribbontail stingray.[5] Morphological examination has suggested that the bluespotted ribbontail ray is more closely related to the amphi-American Himantura (H. pacifica and H. schmardae) and the river stingrays (Potamotrygonidae) than to the congeneric blotched fantail ray (T. meyeni), which is closer to Dasyatis and Indo-Pacific Himantura.[6]

Distribution and habitat

Widespread in the nearshore waters of the tropical Indo-Pacific region, the bluespotted ribbontail ray has a range that extends around the periphery of the Indian Ocean from South Africa to the Arabian Peninsula to Southeast Asia, including Madagascar, Mauritius, Zanzibar, the Seychelles, Sri Lanka, and the Maldives. It is rare in the Persian Gulf and Gulf of Oman.[1][7] In the Pacific Ocean, this species is found from the Philippines to northern Australia, as well as around numerous Melanesian and Polynesian islands as far east as the Solomon Islands.[1] Rarely found deeper than 30 m (100 ft), the bluespotted ribbontail ray is a bottom-dwelling species that frequents coral reefs and adjacent sandy flats. It is also commonly encountered in the intertidal zone and tidal pools, and has been sighted near seagrass beds.[1][8] Every summer, considerable numbers of bluespotted ribbontail rays arrive off South Africa.[3]

Description

Photo of a stingray lying on sand, showing its oval shape and brilliant blue spots
The bluespotted ribbontail ray has distinctive coloration.

The pectoral fin disc of the bluespotted ribbontail ray is oval in shape, around four-fifths as wide as long, with a rounded to broadly angular snout. The large, protruding eyes are immediately followed by the broad spiracles. There is a narrow flap of skin between the nares with a fringed posterior margin, reaching past the mouth. The lower jaw dips at the middle and deep furrows are present at the mouth corners. There are 15–24 tooth rows in either jaw, arranged into pavement-like plates, and two large papillae on the floor of the mouth.[3][9] The pelvic fins are narrow and angular. The thick, depressed tail measures about 1.5 times the disc length and bears one or two (usually two) serrated spines well behind the tail base; there is a deep fin fold on the ventral surface, reaching the tip of the tail, and a low midline ridge on the upper surface.[7][9]

The skin is generally smooth, save for perhaps a scattering of small thorns on the middle of the back.[9] The dorsal coloration is striking, consisting of numerous circular, neon blue spots on a yellowish brown or green background; the spots vary in size, becoming smaller and denser towards the disc margin. The tail has two stripes of the same blue running along each side as far as the spines. The eyes are bright yellow and the belly is white.[3][8] Individuals found off southern Africa may lack the blue tail stripes.[10] The bluespotted ribbontail ray grows to 35 cm (14 in) across, 80 cm (31 in) long, and 5 kg (11 lb).[5][11]

Biology and ecology

Photo of a stingray from the front, as it rests right next to a coral ledge
The bluespotted ribbontail ray hides amongst coral during the day.

One of the most abundant stingrays inhabiting Indo-Pacific reefs, the bluespotted ribbontail ray generally spends the day hidden alone inside caves or under coral ledges or other debris (including from shipwrecks), often with only its tail showing.[8][9][12] At night, small groups assemble and swim onto shallow sandy flats with the rising tide to feed. Unlike many other stingrays, this species seldom buries itself in sand.[13] The bluespotted ribbontail ray excavates sand pits in search of molluscs, polychaete worms, shrimps, crabs, and small benthic bony fishes; when prey is located, it is trapped by the body of the ray and maneuvered into the mouth with the disc. Other fishes, such as goatfish, frequently follow foraging rays, seeking food missed by the ray.[10][14]

Breeding in the bluespotted ribbontail ray occurs from late spring to summer; the male follows the female and nips at her disc, eventually biting and holding onto her for copulation.[14] There is also a documented instance of a male holding onto the disc of a smaller male bluespotted stingray (Dasyatis kuhlii), in a possible case of mistaken identity. Adult males have been observed gathering in shallow water, which may relate to reproduction.[12] Like other stingrays, this species is aplacental viviparous: the embryos are initially sustained by yolk, which later in development is supplemented by histotroph ("uterine milk", containing mucus, fat, and proteins) produced by the mother. The gestation period is uncertain, but is thought to be between four to twelve months long. Females bear litters of up to seven young, each a miniature version of the adult measuring around 13–14 cm (5.1–5.5 in) across.[13][15] Males attain sexual maturity at a disc width of 20–21 cm (7.9–8.3 in); the maturation size of females is unknown.[5][15]

Known predators of the bluespotted ribbontail ray include hammerhead sharks (Sphyrna) and bottlenose dolphins (Tursiops); it is also potentially preyed upon by other large fishes and marine mammals.[13][16] When threatened, this ray tends to flee at high speed in a zigzag pattern, to throw off pursuers.[8] Numerous parasites have been identified from this species: the tapeworms Aberrapex manjajiae,[17] Anthobothrium taeniuri,[18] Cephalobothrium taeniurai,[19] Echinobothrium elegans and E. helmymohamedi,[20][21] Kotorelliella jonesi,[22] Polypocephalus saoudi,[23] and Rhinebothrium ghardaguensis and R. taeniuri,[24] the monogeneans Decacotyle lymmae,[25] Empruthotrema quindecima,[26] Entobdella australis,[27] and Pseudohexabothrium taeniurae,[28] the flatworms Pedunculacetabulum ghardaguensis and Anaporrhutum albidum,[29][30] the nematode Mawsonascaris australis,[31] the copepod Sheina orri,[32] and the protozoan Trypanosoma taeniurae.[33] This ray has been observed soliciting cleanings from the bluestreak cleaner wrasse (Labroides dimidiatus) by raising the margins of its disc and pelvic fins.[12]

Human interactions

While timid and innocuous towards humans, the bluespotted ribbontail ray is capable of inflicting an excruciating wound with its venomous tail spines.[13] Its attractive appearance and relatively small size has resulted in its being the most common stingray found in the home aquarium trade.[34] However, it seldom fares well in captivity and very few hobbyists are able to maintain one for long.[12] Many specimens refuse to feed in the aquarium, and even seemingly healthy individuals often inexplicably die or stop feeding.[12] The bluespotted ribbontail ray is utilized as food in East Africa, Southeast Asia, and Australia; it is captured intentionally or incidentally using gillnets, longlines, spears, and fence traps.[1][15]

The International Union for Conservation of Nature (IUCN) has assessed the bluespotted ribbontail ray as Near Threatened. Although still relatively common and widely distributed, this species faces continuing degradation of its coral reef habitat throughout its range, from development and destructive fishing practices using cyanide or dynamite. In addition, its populations are under heavy pressure by artisanal and commercial fisheries, and by local collecting for the aquarium trade.[1]

References

  1. ^ a b c d e f Compagno, L.J.V. (2005). Taeniura lymma. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved November 13, 2009.
  2. ^ a b Eschmeyer, W.N. and R. Fricke, eds. lymma, Raja. Catalog of Fishes electronic version (January 15, 2010). Retrieved on February 17, 2010.
  3. ^ a b c d Van der Elst, R. (1993). A Guide to the Common Sea Fishes of Southern Africa (third ed.). Struik. p. 52. ISBN 1-86825-394-5. 
  4. ^ Eschmeyer, W.N. and R. Fricke, eds. Taeniura. Catalog of Fishes electronic version (January 15, 2010). Retrieved on February 17, 2010.
  5. ^ a b c d Froese, Rainer, and Daniel Pauly, eds. (2009). "Taeniura lymma" in FishBase. November 2009 version.
  6. ^ Lovejoy, N.R. (1996)). "Systematics of myliobatoid elasmobranchs: with emphasis on the phylogeny and historical biogeography of neotropical freshwater stingrays (Potamotrygonidae: Rajiformes)". Zoological Journal of the Linnean Society 117 (3): 207–257. doi:10.1111/j.1096-3642.1996.tb02189.x. 
  7. ^ a b Randall, J.E. and J.P. Hoover (1995). Coastal Fishes of Oman. University of Hawaii Press. p. 47. ISBN 0-8248-1808-3. 
  8. ^ a b c d Ferrari, A. and A. Ferrari (2002). Sharks. Firefly Books. pp. 214–215. ISBN 1-55209-629-7. 
  9. ^ a b c d Last, P.R. and L.J.V. Compagno (1999). "Myliobatiformes: Dasyatidae". In Carpenter, K.E. and V.H. Niem. The Living Marine Resources of the Western Central Pacific (Volume 3). Rome: Food and Agricultural Organization of the United Nations. pp. 1479–1505. ISBN 92-5-104302-7. 
  10. ^ a b Heemstra, P. and E. Heemstra (2004). Coastal Fishes of Southern Africa. NISC and SAIAB. p. 84. ISBN 1-920033-01-7. 
  11. ^ Van Der Elst, R. and D. King (2006). A Photographic Guide to Sea Fishes of Southern Africa. Struik. p. 17. ISBN 1-77007-345-0. 
  12. ^ a b c d e Michael, S.W. (1993). Reef Sharks & Rays of the World. Sea Challengers. p. 88. ISBN 0-930118-18-9. 
  13. ^ a b c d Bester, C. Biological Profiles: Bluespotted Ribbontail Ray. Florida Museum of Natural History Ichthyology Department. Retrieved on November 13, 2009.
  14. ^ a b Miller, J. (2002). Taeniura lymma (On-line). Animal Diversity Web. Retrieved on November 13, 2009.
  15. ^ a b c Last, P.R. and J.D. Stevens (2009). Sharks and Rays of Australia (second ed.). Harvard University Press. pp. 459–460. ISBN 0-674-03411-2. 
  16. ^ Mann, J. and B. Sargeant (2003). "Like mother, like calf: the ontogeny of foraging traditions in wild Indian Ocean bottlenose dolphins (Tursiops sp.)". In Fragaszy, D.M. and S. Perry. The Biology of Traditions: Models and Evidence. Cambridge University Press. ISBN 0-521-81597-5. 
  17. ^ Jensen, K. (June 2006). "A new species of Aberrapex Jensen, 2001 (Cestoda: Lecanicephalidea) from Taeniura lymma (Forsskal) (Myliobatiformes: Dasyatidae) from off Sabah, Malaysia". Systematic Parasitology 64 (2): 117–123. doi:10.1007/s11230-005-9026-2. PMID 16612652. 
  18. ^ Saoud, M.F.A. (1963). "On a new cestode, Anthobothrium taeniuri n. sp. (Tetraphyllidea) from the Red Sea Sting Ray and the relationship between Anthobothrium van Beneden, 1850, Rhodobothrium Linton, 1889 and Inermiphyllidium Riser, 1955". Journal of Helminthology 37: 135–144. doi:10.1017/S0022149X00019696. PMID 13976441. 
  19. ^ Ramadan, M.M. (1986). "Cestodes of the genus Cephalobothrium Shipley and Hornel, 1906 (Lecanicephaliidae), with description of C. ghardagense n. sp. and C. taeniurai n. sp. from the Red Sea fishes". Japanese Journal of Parasitology 35 (1): 11–15. 
  20. ^ Tyler, G.A. (II) (2006). "Tapeworms of elasmobranchs (part II) a monograph on the Diphyllidea (Platyhelminthes, Cestoda)". Bulletin of the University of Nebraska State Museum 20: i–viii, 1–142. 
  21. ^ Saoud, M.F.A., M.M. Ramadan and S.I. Hassan (1982). "On Echinobothrium helmymohamedi n. sp. (Cestoda: Diphyllidea): a parasite of the sting ray Taeniura lymma from the Red Sea". Journal of the Egyptian Society of Parasitology 12 (1): 199–207. PMID 7086222. 
  22. ^ Palm, H.W. and I. Beveridge (May 2002). "Tentaculariid cestodes of the order Trypanorhyncha (Platyhelminthes) from the Australian region". Records of the South Australian Museum 35 (1): 49–78. 
  23. ^ Hassan, S.H. (December 1982). "Polypocephalus saoudi n. sp. Lecanicephalidean cestode from Taeniura lymma in the Red Sea". Journal of the Egyptian Society of Parasitology 12 (2): 395–401. PMID 7153551. 
  24. ^ Ramadan, M.M. (1984). "A review of the cestode genus Rhinebothrium Linton, 1889 (Tetraphyllidae), with a description of two new species of the sting ray Taeniura lymma from the Red Sea". Journal of the Egyptian Society of Parasitology 14 (1): 85–94. PMID 6736718. 
  25. ^ Cribb, B.W.; Whittington, Ian D. (2004). "Anterior adhesive areas and adjacent secretions in the parasitic flatworms Decacotyle lymmae and D. tetrakordyle (Monogenea: Monocotylidae) from the gills of stingrays". Invertebrate Biology 123 (1): 68–77. doi:10.1111/j.1744-7410.2004.tb00142.x. 
  26. ^ Chisholm, L.A. and I.D. Whittington (1999). "Empruthotrema quindecima sp. n. (Monogenea: Monocotylidae) from the nasal fossae of Taeniura lymma (Dasyatididae) from Heron Island and Lizard Island, Great Barrier Reef, Queensland, Australia". Folia Parasitologica 46 (4): 274–278. 
  27. ^ Whittington, I.D. and B.W. Cribb (April 1998). "Glands associated with the anterior adhesive areas of the monogeneans, Entobdella sp. and Entobdella australis (Capsalidae) from the skin of Himantura fai and Taeniura lymma (Dasyatididae)". International Journal for Parasitology 28 (4): 653–665. doi:10.1016/S0020-7519(98)00016-2. PMID 9602390. 
  28. ^ Agrawal, N., L.A. Chisholm and I.D. Whittington (February 1996). "Pseudohexabothrium taeniurae n. sp. (Monogenea: Hexabothriidae) from the gills of Taeniura lymma (Dasyatididae) from the Great Barrier Reef, Australia". The Journal of Parasitology 82 (1): 131–136. doi:10.2307/3284128. JSTOR 3284128. PMID 8627482. 
  29. ^ Saoud, M.F.A. and M.M. Ramadan (1984). "Two trematodes of genus Pedunculacetabulum Yamaguti, 1934 from Red Sea fishes". Journal of the Egyptian Society of Parasitology 14 (2): 321–328. PMID 6512282. 
  30. ^ Razarihelisoa, M. (1959). "Sur quelques trematodes digenes de poissons de Nossibe (Madagascar)". Bulletin de la Société Zoologique de France 84: 421–434. 
  31. ^ Sprent, J.F.A. (1990). "Some ascaridoid nematodes of fishes: Paranisakis and Mawsonascaris n. g". Systematic Parasitology 15 (1): 41–63. 
  32. ^ Kornicker, L.S. (1986). "Redescription of Sheina orri Harding, 1966, a myodocopid ostracode collected on fishes off Queensland, Australia". Proceedings of the Biological Society of Washington 99 (4): 639–646. 
  33. ^ Burreson, E.M. (1989). "Haematozoa of fishes from Heron I., Australia, with the description of two new species of Trypanosoma". Australian Journal of Zoology 37 (1): 15–23. doi:10.1071/ZO9890015. 
  34. ^ Burgess, W.E., H.R. Axelrod and R.E. Hunziker (2000). Dr. Burgess's Atlas of Marine Aquarium Fishes (third ed.). T.F.H. Publications. p. 676. ISBN 0-7938-0575-9. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!