Overview

Comprehensive Description

Biology

Feeds on worms, crustaceans, insects, plant matter. The black variety (Black molly) is a very popular aquarium fish and is marketed throughout the world (Ref. 1739). In the aquarium it feeds on green algae and also readily accepts dried food (Ref. 1672). Minimum aquarium size 60 cm (Ref. 51539).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Native to eastern Mexico and Guatemala. Locally established in Hawaii, Montana, Nevada, and possibly Florida; reported from California (Fuller et al. 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Central and South America: Mexico to Colombia. Often confused with Poecilia mexicana (Ref. 1739).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North, Central and South america: Mexico to Colombia: Colombia, Curaçao Island, Mexico, Trinidad and Tobago (introduced), and Venezuela.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 60 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

6.0 cm TL (male/unsexed; (Ref. 50894))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Platypoecilus mentalis
Catalog Number: USNM 16675
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1875
Locality: Atlantic Side Panama, Panama, Caribbean Sea, Atlantic
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 1 - 1
  Temperature range (°C): 25.335 - 25.335
  Nitrate (umol/L): 0.130 - 0.130
  Salinity (PPS): 35.376 - 35.376
  Oxygen (ml/l): 4.757 - 4.757
  Phosphate (umol/l): 0.120 - 0.120
  Silicate (umol/l): 1.185 - 1.185
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Freshwater

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

benthopelagic; non-migratory; freshwater; brackish; pH range: 7.5 - 8.2; dH range: 11 - 30
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 1 - 1
  Temperature range (°C): 25.335 - 25.335
  Nitrate (umol/L): 0.130 - 0.130
  Salinity (PPS): 35.376 - 35.376
  Oxygen (ml/l): 4.757 - 4.757
  Phosphate (umol/l): 0.120 - 0.120
  Silicate (umol/l): 1.185 - 1.185
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Feeds on worms, crustaceans, insects, plant matter.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Parasitic Copepod Infestation (general). Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Capillaria Infestation 5. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Produces 20 to 150 young after 28 days gestation.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Poecilia sphenops

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTTTATCTAGTATTTGGTGCTTGAGCCGGCATAGTGGGGACAGCTCTGAGTCTTTTAATCCGAGCCGAACTCAGTCAACCAGGATCCCTCCTAGGTGATGATCAAATTTATAATGTAATCGTCACAGCTCATGCCTTTGTAATAATCTTTTTTATGGTCATGCCAATTATAATTGGCGGCTTTGGTAATTGACTAGTACCACTAATAATTGGTGCCCCTGATATAGCCTTCCCGCGAATGAATAATATGAGCTTCTGACTTCTACCACCCTCATTCCTCCTCCTCCTCGCATCTTCTGGAGTAGAAGCAGGGGCTGGTACAGGTTGAACCGTCTACCCCCCTCTCGCAAGCAATTTAGCCCACGCTGGACCCTCCGTAGATCTAACTATTTTTTCACTTCACCTGGCAGGTATTTCCTCCATCCTAGGGGCAATCAACTTTATTACCACCATCATTAATATAAAACCCCCTGCAGCATCTCAGTACCAAACACCCCTATTTGTCTGAGCTGTAATGATTACAGCTGTACTCCTACTTCTCTCTCTTCCTGTCCTCGCCGCTGGTATCACCATGCTTCTAACAGATCGAAATCTAAACACCACTTTCTTTGACCCTGCAGGAGGGGGAGATCCAATTCTTTACCAACACTTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Poecilia sphenops

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
2.3

Year Assessed
1996
  • Needs updating

Assessor/s
World Conservation Monitoring Centre

Reviewer/s

Contributor/s

History
  • 1994
    Indeterminate (I)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Data deficient (DD)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest; aquarium: highly commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Poecilia sphenops

Female Black Molly

Poecilia sphenops is a species of fish, of the genus Poecilia, known under the common name molly; to distinguish it from its congeners, it is sometimes called short-finned molly or common molly. They inhabit fresh water streams and coastal brackish and marine waters of Mexico. The wild-type fish are a dull silvery color, often sprinkled black all over. The common molly can produce fertile hybrids with many Poecilia species, most importantly the sailfin molly. The male black mollies generally tend to be mildly aggressive. Although they are compatible tankmates with fish such as tiger barbs, they will chase them.

Mollies rank as one of the most popular feeder fish due to high growth rate, birth size, reproduction,and brood number.

Biology[edit]

Contrary to popular belief, this species of fish is actually a freshwater species, spending little time in brackish water before swimming back to their freshwater biotope. However, fish of the same species have been found in coastal sea waters, brackish swamps and freshwater streams, living and breeding. Mollies appear to be a hardy and highly adaptable species (this has been diluted over years of interbreeding in tank-bred specimens).

Size[edit]

Standard size of male fish is 3.2″ (8cm) and female fish is 4.8″ (12cm).

Varieties[edit]

Selective breeding over centuries has produced several color variations and different body shapes.

Short-Finned Molly or Common Molly: They inhabit fresh water streams and coastal brackish and marine waters of Mexico. The wild-type fish are a dull silvery color, often sprinkled black all over. The common molly can produce fertile hybrids with many Poecilia species, most importantly the sailfin molly. The wild form is in fact quite rarely kept, as it has a rather plain silvery coloration suffused with brown and green hues.

Black Molly or Midnight Molly: This variety actually originated from hybrids between Poecilia sphenops and the sailfin molly. Due to genomic recombination, F1 hybrids often display novel and bizarre fin shapes. It is a melanistic breed which are black all over. It is one of the most well-known aquarium fishes and nearly as easy to keep and prolific as guppies.

Golden Molly: Nicknamed the "24 karat".

Balloon Molly: This fish has a deformed spine due to a genetic defect that gives it its appearance. Through Selective breeding, similar to many dog breeds such as pugs, it is now widely available. Balloon mollies can still reproduce and live a normal life comparable to that of other mollies, but it has garnered controversy due to the belief that it's defect gives it a shortened lifespan and a susceptibility to health problems.

Lyretail: A breed with an altered caudal fin structure.

sailfin molly: A breed with an altered caudal fin structure.

Dalmatian Molly: A silver colored breed with black speckles.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Poecilia vetiprovidentiae

Poecilia vetiprovidentiae is a species of fish in the Poeciliidae family that is endemic to Colombia.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: See Breden et al. (1999) for a molecular phylogeny of POECILIA.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!