Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Found on the continental shelf (Ref. 75154). A rare inhabitant of rocky bottoms of deep offshore reefs. Normally found on soft-bottom or muddy substrates with rich rubble ridges amongst rich invertebrate growth, especially sponges (Ref. 48635). Sold fresh in small quantities in markets.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-West Pacific: Durban in South Africa, Sri Lanka, India, and New Guinea. First recorded in the northeastern Indian Ocean from Indonesia and Australia (Ref. 5978).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: East and South Africa east to Indonesia and northern Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13; Dorsal soft rays (total): 10; Analspines: 3; Analsoft rays: 6 - 7
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 160 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

20.0 cm SL (male/unsexed; (Ref. 48635))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Rare. Found apparently on deeper reefs over rocky bottoms. Sold fresh in small quantities in markets.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reddish brown with alternating broad and thin dark bars separated by white; dark spot on cheek; small tentacle above eye which may be banded; upper half of pectorals with large dark spots on inner surface (Ref. 4313).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range ? - 60 m, usually 40 - ? m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 8 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 3.05 - 100
  Temperature range (°C): 25.737 - 26.770
  Nitrate (umol/L): 0.218 - 3.114
  Salinity (PPS): 35.048 - 36.032
  Oxygen (ml/l): 4.462 - 4.554
  Phosphate (umol/l): 0.152 - 0.546
  Silicate (umol/l): 3.271 - 4.277

Graphical representation

Depth range (m): 3.05 - 100

Temperature range (°C): 25.737 - 26.770

Nitrate (umol/L): 0.218 - 3.114

Salinity (PPS): 35.048 - 36.032

Oxygen (ml/l): 4.462 - 4.554

Phosphate (umol/l): 0.152 - 0.546

Silicate (umol/l): 3.271 - 4.277
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 60m.
Recorded at 60 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pterois mombasae

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTGTATCTAGTATTTGGTGCCTGAGCCGGTATAGTAGGCACAGCCTTGAGCCTACTTATTCGAGCAGAACTTAGTCAACCAGGCGCCCTGTTAGGGGATGACCAGATCTATAATGTAATTGTTACAGCCCATGCGTTCGTAATAATTTTCTTTATAGTAATACCAATCATGATTGGAGGTTTTGGAAACTGACTTATCCCATTAATGATCGGGGCACCAGACATAGCATTTCCTCGTATAAATAACATAAGCTTTTGACTCCTTCCCCCCTCTTTTCTACTTCTTCTAGCCTCTTCGGGGGTTGAAGCAGGGGCTGGAACAGGTTGAACAGTCTACCCGCCCTTGGCGGGCAACCTTGCCCACGCGGGGGCATCTGTAGACCTAACAATTTTTTCCTTGCACTTAGCAGGTATTTCATCAATTCTAGGGGCCATTAACTTTATCACAACAATTATTAACATGAAACCCCCAGCAATTTCTCAGTACCAGACTCCTTTATTTGTATGGGCTGTTTTAATTACGGCAGTTCTTCTACTTCTTTCACTACCAGTCCTTGCCGCTGGTATTACAATGCTACTCACTGATCGAAACCTTAATACCACCTTCTTCGACCCGGCAGGGGGAGGAGACCCGATTCTTTACCAACACCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pterois mombasae

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; price category: high; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Frillfin turkeyfish

The frillfin turkeyfish (Pterois mombasae) is a fish found in the tropical Indian Ocean and the Western Pacific, typically in soft-bottomed areas of the ocean, often in conjunction with invertebrate growth (for example, sponges). It grows to a maximum size of 20 cm, and is of moderate commercial value.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!