Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Occurs in lagoons, reef flats and seaward reefs (Ref. 1602, 48635). Prefers protected inshore waters among dead corals, common in harbors and small caves (Ref. 30404). Probably nocturnal (Ref. 1602). Feeds on fishes and crustaceans (Ref. 9710). Possibly a protogynous hermaphrodite (Ref. 32169). Current age of a captive individual is 18 years, which exceeds 100 cm and approximately 10 lbs (owner Mark Palermo, pers. comm. 07/12).
  • Chen, H.-M., K.-T. Shao and C.T. Chen 1994 A review of the muraenid eels (Family Muraenidae) from Taiwan with descriptions of twelve new records. Zool. Stud. 33(1):44-64. (Ref. 6934)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-Pacific: Madagascar (Ref. 33390) to the Society Islands, north to southern Japan (Ref. 559), south to Queensland, Australia; throughout Micronesia.
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: Seychelles, Madagascar and Mascarenes east to Mariana Islands, Marquesas Islands and Tuamotu Archipelago, north to Ryukyu Islands and Ogasawara Islands, south to Western Australia at 20°30'S, southern Queensland (Australia) and New Cale
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Vertebrae: 128 - 142
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 800 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

80.0 cm TL (male/unsexed; (Ref. 1602))
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Adults pale with small black spots on face; black spots proportionally much larger in young (Ref. 30404).Description: Characterized by generally pale tan or greyish brown color; frequently with yellow hue on head; highly variable pattern of widely spaced, irregular dark brown to black spots and partial bars on body and fins; body depth at gill opening 14-18 in TL; high dorsal fin; dorsal fin origin slightly anterior to gill opening; anus slightly anterior to middle of body; narrow jaws, lower slightly curved; front jaw teeth in single row; anterior canines of upper jaw alternating with small pointed teeth; short inner row of canines at side of upper jaw; two pairs of elongate canines anteriorly in lower jaw (Ref 90102).
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Occurs in lagoons, reef flats, and seaward reefs to depths of at least 26 m. Probably nocturnal (Ref. 1602). Feeds on fishes and crustaceans (Ref. 9710).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; brackish; marine; depth range 7 - 50 m (Ref. 90102)
  • Allen, G.R. and M.V. Erdmann 2012 Reef fishes of the East Indies. Perth, Australia: Universitiy of Hawai'i Press, Volumes I-III. Tropical Reef Research. (Ref. 90102)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 159 specimens in 1 taxon.
Water temperature and chemistry ranges based on 123 samples.

Environmental ranges
  Depth range (m): 0.2 - 78
  Temperature range (°C): 24.659 - 29.336
  Nitrate (umol/L): 0.016 - 2.632
  Salinity (PPS): 32.200 - 36.148
  Oxygen (ml/l): 4.290 - 4.883
  Phosphate (umol/l): 0.083 - 0.351
  Silicate (umol/l): 0.974 - 7.618

Graphical representation

Depth range (m): 0.2 - 78

Temperature range (°C): 24.659 - 29.336

Nitrate (umol/L): 0.016 - 2.632

Salinity (PPS): 32.200 - 36.148

Oxygen (ml/l): 4.290 - 4.883

Phosphate (umol/l): 0.083 - 0.351

Silicate (umol/l): 0.974 - 7.618
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 45m.
Recorded at 45 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Often with coral reefs (Ref. 9137).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Protogyny unconfirmed (Ref. 84746).
  • Fishelson, L. 1992 Comparative gonad morphology and sexuality of the Muraenidae (Pisces, Teleostei). Copeia 1992(1):197-209. (Ref. 32169)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gymnothorax fimbriatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TCGGCACTGCACTAAGTCTCCTTATCCGGGCAGAACTCAGCCAGCCTGGTGCCCTTTTAGGTGACGACCAGATCTATAATGTTATTGTTACAGCACATGCATTCGTAATAATTTTCTTTATAGTAATGCCTGTTATAATTGGAGGCTTTGGAAACTGGCTTATTCCACTAATAATTGGCGCTCCTGATATAGCATTCCCTCGAATAAACAATATGAGCTTCTGACTTCTTCCCCCTTCCTTCCTTCTACTTTTAGCCTCCTCTGGGGTTGAAGCAGGAGCAGGAACCGGATGAACTGTTTACCCCCCTCTTGCAGGAAACCTCGCACATGCAGGAGCCTCTGTAGATCTAACCATCTTCTCCCTTCATCTAGCAGGAGTATCCTCTATCTTAGGGGCAATCAACTTTATTACTACTATCATTAACATAAAACCCCCAGCCATTACACAGTACCAAACACCACTATTTGTTTGAGCGGTACTGGTTACTGCAGTTCTTCTTTTACTCTCCCTTCCGGTACTAGCGGCTGGAATCACGATACTGCTAACCGATCGAAACCTGAATACTACCTTCTGTGACCCTGCTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Gymnothorax fimbriatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: subsistence fisheries
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Fimbriated moray

The fimbriated moray, Gymnothorax fimbriatus, is a moray eel of the family Muraenidae, found in the Indo-Pacific oceans, around reefs, harbours and small caves, at depths down to 45 meters. It is pale green-yellow in color with black spots on its face and can reach a maximum length of 80 cm. It feeds mainly on small fish.

References[edit source | edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!