Overview

Comprehensive Description

Biology

Adults inhabit lagoon and seaward reefs (Ref. 9710), found mainly in protected coastal waters and lagoons. Typically found in pairs in which males are much smaller than females (Ref. 48636). Feed primarily on zooplankton and benthic algae (Ref. 4966). Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205). Associated with the anemone Entacmaea quadricolor (Ref. 5911). Have been reared in captivity (Ref. 35404, 35413, 35420).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-West Pacific: Indo-Australian Archipelago including India, Burma, Thailand, Malaysia, Indonesia, Philippines, New Guinea, New Britain, Solomon Islands, Vanuatu, and Australia (northern Queensland).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Spinecheek anemonefish, Premnas biaculeatus, are found in the Indo-West Pacific, including the coasts of India, Burma, Thailand, Malaysia, Indonesia, Philippines, New Guinea, New Britain, Solomon Islands, Vanuatu and northern Queensland.

Biogeographic Regions: indian ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Madagascar, Mauritius
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 10; Dorsal soft rays (total): 17 - 18; Analspines: 2; Analsoft rays: 13 - 15
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Spinecheek anemonefish are among the easiest anemonefish to identify, even when young. They are bright red with 3 bars that are bright white in males and grey in females. Individuals may become bright white if they are provoked. The lines may also be bright yellow.

Range length: <60 to 160 mm.

Average length: 70 mm.

Sexual Dimorphism: female larger; male more colorful

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 170 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

17.0 cm TL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Has a distinctive prominent preopercular spine that extends across the head-bar. Juveniles and males bright red, females become maroon to nearly black (Ref. 37816). Males are much smaller than females (Ref. 48636).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Inhabits lagoons and outer reef slopes in 1 to 16 metres. Commensal with sea anemones, usually Radianthus gelam. Also reported to be associated with the anemone Entacmaea quadricolor, found mainly in protected coastal waters and lagoons. Feeds primarily on zooplankton and benthic algae (Ref. No. 4966).<111>
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; non-migratory; marine; depth range 1 - 16 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The most important aspect of spinecheek anemonefish habitat is the host anemone. Entacmaea quadricolor, bulb-tentacle sea anemones, are the only host species for spinecheek anemonefish. This anemone species is characterized by polyps 50 to 400 mm in diameter, depending on depth. They have brown tentacles of about 100 mm long with a red tip and white bulb at the end of the tentacle. Spinecheek anemonefish tend to live mainly in solitary specimens of Entacmaea quadricolor on reef slopes. The typical water depth is less than 50 m, because anemones require sunlight to grow. The mutualistic zooxanthellae (living within the anemone) need this sunlight to photosynthesize and provide energy for themselves and the anemone. These anemone prefer tropical warm waters with the temperature ranging between 25 and 28°C (77-82°F).

Range depth: 50 (high) m.

Habitat Regions: tropical ; saltwater or marine

Aquatic Biomes: reef ; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 14 specimens in 1 taxon.
Water temperature and chemistry ranges based on 8 samples.

Environmental ranges
  Depth range (m): 0.9 - 9.1
  Temperature range (°C): 26.803 - 29.205
  Nitrate (umol/L): 0.090 - 0.580
  Salinity (PPS): 32.019 - 34.975
  Oxygen (ml/l): 4.202 - 4.666
  Phosphate (umol/l): 0.131 - 0.415
  Silicate (umol/l): 1.005 - 5.552

Graphical representation

Depth range (m): 0.9 - 9.1

Temperature range (°C): 26.803 - 29.205

Nitrate (umol/L): 0.090 - 0.580

Salinity (PPS): 32.019 - 34.975

Oxygen (ml/l): 4.202 - 4.666

Phosphate (umol/l): 0.131 - 0.415

Silicate (umol/l): 1.005 - 5.552
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 1 - 16m.
From 1 to 16 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Inhabits lagoon and seaward reefs (Ref. 9710). Commensal with sea anemones, usually Radianthus gelam. Also reported to be associated with the anemone Entacmaea quadricolor, found mainly in protected coastal waters and lagoons. Feeds primarily on zooplankton and benthic algae.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Spinecheek anemonefish have a diet rich in copepods and planktonic, larval tunicates. They also eat other kinds of plankton and algae.

Animal Foods: aquatic or marine worms; aquatic crustaceans; other marine invertebrates; zooplankton

Plant Foods: algae; phytoplankton

Primary Diet: carnivore (Eats non-insect arthropods, Eats other marine invertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Spinecheek anemonefish and their host anemones have a mutualist relationship. Entacmaea quadricolor benefits from having spinecheek anemonefish protect them from butterflyfish (Chaetodontidae), which would otherwise eat their tentacles. Spinecheek anemonefish also clean away debris and parasites from the anemone. Spinecheek anemonefish are protected from most predators through their association with venomous anemones.

Mutualist Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

The most vulnerable stage for spinecheek anemonefish is during the egg and larval stage, when they are not protected by a host anemone and float freely in the water column. As settled adults, Entacmaea quadricolor protects these symbiotic fish because of their ability to deliver a venomous sting. Wrasses are known to prey on eggs and other fish are likely predators of eggs, larvae, and unsettled juveniles.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Uronema infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Mates communicate in courtship through movement and touch. During spawning, females swim in a zig-zag pattern over the nest while the male fertilizes the eggs. Males also “shows off” their fins to females, a form of visual communication.

Communication Channels: visual ; tactile

Perception Channels: visual

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Development

The developmental stages of spinecheek anemonefish are egg, larvae, young and adult. The transparent, elliptical eggs are 3-4 mm in size. Anemonefish hatch with advanced alimentary canals and feed on the yolk, which usually lasts for about 3 days. Five days after hatching they develop supranuclear inclusions around the hindgut, which suggests pinocytotic digestion of protein. Between 3 to 5 days after hatching is the period of highest mortality stage for anemonefish if they cannot find food. It is also the time when they transition from endogenous to exogenous feeding. Seven days after hatching they attain gastric glands and by the 9th day they have supranuclear vacuoles that indicate exogenous digestive capabilities. Spinecheek anemonefish hatch 6 to 7 days after fertilization, and then undergo a 7 to 14 day pelagic larval stage. After fertilization, they complete the development of the olfactory organ in 19 days, retinal differentiation in 20 days and skeletal ossification in about 22 days. Spinecheek anemonefish develop more rapidly than other anemonefish species. Their eyes develop especialy rapidly. Vision is directly correlated with the ability to attain food because most larval fish are visual feeders. Olfactory cues are used to detect host anemones. During the larval stage spinecheek anemonefish live on the water surface where they are transported by currents.

Metamorphosis occurs when anemonefish leave surface waters and swim to the sea bottom. It then takes on the color pattern of a juvenile. This process usually takes about one day. This marks the beginning of the settlement period, in which individuals seek out an uninhabited anemone host.

Spinecheek anemonefish, like other anemonefish species, are protandrous hermaphrodites, which means that they change from male to female. Females have gonads that function as ovaries with leftover male testicular tissue. In the case of spinecheek anemonefish, males may be half the size of females and their gonads have dormant ovarian cells as well as functioning testes.

Development - Life Cycle: metamorphosis

  • Kavanagh, K., R. Alford. 2003. Sensory and skeletal development and growth in relation to the duration of the embryonic and larval stages in damselfishes. Biological Journal of the Linnean Society, 80: 187-206.
  • Job, S., D. Bellwood. 1996. Visual acuity and feeding in larval Premnas biaculeatus. Journal of Fish Biology, 48: 952-963.
  • Coughlin, D. 1994. Suction Prey Capture by Clownfish Larvae (Amphiprion perideraion). Copeia, 1: 242-246.
  • Gordon, A., T. Hecht. 2002. Histological studies on the development of the digestive system of the clownfish Amphiprion percula and the time of weaning. J. Appl. Ichthyol., 18: 113-117. Accessed April 11, 2006 at www.blackwell.de/synergy.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The lifespan of spinecheek anemonefish has not been well researched. They live longer in the wild, ranging from 6 to 10 years, and about 3 to 5 years in captivity under good conditions. A related species, Amphiprion perideraion, was recorded living to 18 years.

Typical lifespan

Status: wild:
6 to 10 years.

Typical lifespan

Status: captivity:
3 to 5 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Spinecheek anemonefish have a monogamous mating system and mated pairs may stay together for several years. The dominant female is the largest and has one partner, which is the next largest male within a cluster of anemones. The growth of other anemonefish in the same anemone patch is stunted by the presence of a dominant male and female, keeping them smaller than the dominant male. When one or the other of the dominant individuals dies, subordinates grow and replace the dead individual. For example, if the dominant male dies, the next largest male will replace him and continue to grow to its maximum size.

Males, before spawning, go through an extensive ritual of courtship that consists of displaying the dorsal, anal and pelvic fins. He also chases and nips his mate.

Mating System: monogamous

Spinecheek anemonefish may spawn throughout the year in tropical areas. In cooler water they may spawn during the warm season.

Breeding interval: Breeding may occur throughout the year, depending on water temperature.

Breeding season: In the tropics spawning occurs year-round; those in temperate and subtropical waters spawn when the temperatures are highest in summer and spring.

Range number of offspring: 100 to 1000.

Range time to hatching: 6 to 7 days.

Range time to independence: 8 to 12 days.

Key Reproductive Features: iteroparous ; seasonal breeding ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sequential hermaphrodite (Protandrous ); sexual ; fertilization (External ); oviparous

Males care primarily for the eggs. Before spawning, males find and prepare a nest for the eggs. He cleans the area by removing the debris and algae from the area. Usually the female ends up joining in the task. During incubation the male guards and cares for the nest. He chases away any possible predators that may want to feast on the eggs, such as wrasses. Male anemonefish use their pectoral fins to fan the eggs and spend time meticulously removing dead eggs and debris from the nest with their mouths. Females will occasionally assist males but mainly spend their time feeding.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Male)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Premnas biaculeatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATCTAGTATTCGGTGCCTGAGCTGGAATAGTAGGCACAGCTTTAAGCCTTCTTATTCGAGCGGAACTAAGCCAACCAGGCGCGCTCCTAGGAGACGACCAGATTTATAACGTCATCGTTACCGCACATGCCTTCGTAATAATTTTCTTTATAGTAATACCAATTCTGATTGGAGGGTTTGGAAACTGACTAGTCCCCCTTATGATCGGCGCGCCAGATATAGCATTTCCTCGTATAAACAACATAAGCTTCTGACTACTCCCCCCATCTTTCCTCCTTCTGCTTGCCTCCTCAGGAGTTGAAGCCGGCGCCGGAACAGGCTGAACTGTGTACCCCCCACTATCTGGAAACCTGGCCCATGCAGGAGCATCAGTAGACTTGACTATCTTCTCTCTTCACCTGGCAGGCATTTCATCAATCCTGGGGGCAATTAACTTTATCACCACCATTATCAACATGAAGCCCCCCGCCATCACACAGTATCAAACGCCACTATTTGTTTGGGCTGTTCTAGTTACCGCTGTTCTTCTTCTCCTGTCCCTCCCAGTTCTAGCTGCCGGCATCACTATGCTCCTAACAGACCGAAATCTAAATACTACCTTCTTTGACCCGGCAGGCGGAGGAGACCCAATTCTCTATCAACACCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Premnas biaculeatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 21
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Although spinecheek anemonefish are not endangered, there are concerns for populations and their reef habitats due to the "Nemo craze". In the last generation 15 to 30% of the world's reefs have been lost. After release of Disney's "Finding Nemo" movie, which has an anemonefish as its main protagonist, anemonefish sales have increased. Collecting methods are often extremely destructive, permanently damaging reefs.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

  • Osterhoudt, S. 2004. Buying Nemo. E Magazine, July/August: 10.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

There are no known adverse effects of the spinecheek anemonefish on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Spinecheek anemonefish are important to the aquarium suppliers who sell them for profit. These anemonefish, and their relatives, are important ecotourist draws for diving operations. Their symbiotic relationship with Entacmaea quadricolor, helps to protect these anemones.

Positive Impacts: pet trade ; ecotourism ; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Maroon clownfish

The maroon clownfish, Premnas biaculeatus, is a species of clownfish that is found in the Indo-Pacific from western Indonesia to Taiwan and the Great Barrier Reef.[2] They can grow up to be about 17 cm (6. 7 in), and as they grow, they become more aggressive towards other clownfish. It is also known as the spine-cheeked clownfish, or the maroon anemonefish. It is the only member of the genus Premnas, although it has been suggested that the taxon epigrammata from Sumatra should be recognized as a distinct species, Premnas epigrammata (Fowler, 1904).[3]

The stripes across the body are normally white, but they are yellow in the taxon epigrammata. The female is usually larger than the male and dark red or maroon, and the male smaller and a bright red.

In the aquarium [edit]

A 30-gallon tank is suggested for one fish or 60 gallons for a pair. In the wild, it is strictly associated with the sea anemone Entacmaea quadricolor,[2] and preferably this should also be provided in the aquarium (but is not a requirement). The maroon clownfish likes frozen shrimp and herbivore preparations.

Because of its spines, this clownfish should not be caught using a net. The spines can get entangled in the net, which can injure the fish. Instead, catching with a cup is recommended. The maroon clownfish is one of the larger, more aggressive members of the clown family. It is best to house them singly, the only exception being a mated pair. Do not mix maroon clownfish with any other type of clownfish or bullying will occur. A good way to curb their aggression is to rearrange the rock work periodically. Also if it is planned to keep one or a pair it is best to add them last. If the right parameters are met the maroon clown will be a hardy and amusing member of the aquarium community. They are human responsive to the point of trying to "intimidate" people with whom they are not familiar.

Gallery [edit]

References [edit]

  1. ^ a b Bailly, N. (2010). "Premnas biaculeatus (Bloch, 1790)". In Nicolas Bailly. FishBase. World Register of Marine Species. Retrieved 2011-12-23. 
  2. ^ a b Lieske, E., and R. Myers. 1999. Coral Reef Fishes. ISBN 0-691-02659-9
  3. ^ Kuiter, R. H., and H. Debelius. 2007 (2nd edition). World Atlas of Marine Fishes. ISBN 3-925919-77-5
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!