Overview

Comprehensive Description

Biology

Found mostly below depths of 23 m, but occasionally seen in as little as 6 m (Ref. 3921). Benthopelagic (Ref. 58302). Usually found on sand or sand and rubble bottom or algal flats, often in the vicinity of coral reefs (Ref. 83660). Feed on a wide variety of benthic organisms: gastropods, sponges, algae, bivalves, polychaetes, tunicates, crabs, sea urchins, heart urchins, brittle stars, bryozoans, peanut worms, various small crustaceans and foraminiferans (Ref. 3921).
  • Randall, J.E., J.T. Williams and L.A. Rocha 2008 The Indo-Pacific tetraodontid fish Canthigaster coronata, a complex of three species. Smithiana, Publ. Aquatic Biodiv. Bull. 9:3-13. (Ref. 83660)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Former distribution of Hawaii and Tonga to the east coast of Africa and the Red Sea, is divided into three species: C. coronata, endemic to the Hawaiian Islands;C. axiologus from the rest of the Pacific west of the Hawaiian Island; and C. cyanospilota from the Indian Ocean and Red Sea (type locality, Gulf of Aqaba) (Ref. 83660).
  • Randall, J.E., J.T. Williams and L.A. Rocha 2008 The Indo-Pacific tetraodontid fish Canthigaster coronata, a complex of three species. Smithiana, Publ. Aquatic Biodiv. Bull. 9:3-13. (Ref. 83660)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Central Pacific: Johnston Atoll and Hawaiian Islands [see ref. 29943].
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 9 - 11; Analspines: 0; Analsoft rays: 9 - 10
  • Randall, J.E., J.T. Williams and L.A. Rocha 2008 The Indo-Pacific tetraodontid fish Canthigaster coronata, a complex of three species. Smithiana, Publ. Aquatic Biodiv. Bull. 9:3-13. (Ref. 83660)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 135 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

11.0 cm SL (male/unsexed; (Ref. 83660))
  • Randall, J.E., J.T. Williams and L.A. Rocha 2008 The Indo-Pacific tetraodontid fish Canthigaster coronata, a complex of three species. Smithiana, Publ. Aquatic Biodiv. Bull. 9:3-13. (Ref. 83660)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Inhabits sand and rubble bottoms of seaward reefs (Ref. 1602). Found mostly below depths of 23 m, but occasionally seen in as little as 6 m. Feeds on a wide variety of benthic organisms: gastropods, sponges, algae, bivalves, polychaetes, tunicates, crabs, sea urchins, heart urchins, brittle stars, bryozoans, peanut worms, various small crustaceans and foraminiferans.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This species is characterized by the following: D 9-11 (usually 10, rarely 9); A 9-10 (usually 10); pectoral rays 15-18 (usually 17); gill rakers 7-9; body depth between origins of dorsal and anal fins 2.8-3.25 in SL; head length (HL) 2.3-2.55 in SL; interorbital width 3.9-4.45 in HL; gill opening 3.7-4.75 in HL; anal fin origin below or anterior to rear base of dorsal fin, preanal length 1.35-1.4 in SL; longest dorsal ray 2.2-2.5 in HL; preserved colour pale grey to pale tan with 3 triangular dark brown saddle-like bars dorsally on body, progressively more oblique posteriorly, the first extending narrowly to ventral edge of gill opening, the second to level of lower edge of pectoral-fin base and enclosing base of dorsal fin posteriorly, and the last ending at upper base of caudal fin; a dark brown band run across posterior interorbital and anterior occiput; a dark brown spot below base of pectoral fin; head and body with many small pale spots (most about half pupil diameter), faint or absent on paler parts of body but very evident on edges, within dark bars, and on head where ground colour darker; around eye are narrow pale bands and spots; pale lips encircled with a narrow dusky band; a thin dark brown line midventrally on abdomen and chest present or absent (may be broken to long segments); pale fins, with upper and lower margins of caudal fin with a broad brown band, darker at base; when fresh, noteworthy are the many small yellow spots, and the lack of blue spots - blue only between yellow markings around eye (Ref. 83660).
  • Randall, J.E., J.T. Williams and L.A. Rocha 2008 The Indo-Pacific tetraodontid fish Canthigaster coronata, a complex of three species. Smithiana, Publ. Aquatic Biodiv. Bull. 9:3-13. (Ref. 83660)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 6 - 165 m (Ref. 83660)
  • Randall, J.E., J.T. Williams and L.A. Rocha 2008 The Indo-Pacific tetraodontid fish Canthigaster coronata, a complex of three species. Smithiana, Publ. Aquatic Biodiv. Bull. 9:3-13. (Ref. 83660)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 106 specimens in 1 taxon.
Water temperature and chemistry ranges based on 62 samples.

Environmental ranges
  Depth range (m): 6.1 - 50000
  Temperature range (°C): 18.151 - 28.899
  Nitrate (umol/L): 0.006 - 5.586
  Salinity (PPS): 34.165 - 35.503
  Oxygen (ml/l): 3.868 - 4.951
  Phosphate (umol/l): 0.100 - 0.527
  Silicate (umol/l): 1.057 - 9.319

Graphical representation

Depth range (m): 6.1 - 50000

Temperature range (°C): 18.151 - 28.899

Nitrate (umol/L): 0.006 - 5.586

Salinity (PPS): 34.165 - 35.503

Oxygen (ml/l): 3.868 - 4.951

Phosphate (umol/l): 0.100 - 0.527

Silicate (umol/l): 1.057 - 9.319
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 6 - 100m.
From 6 to 100 meters.

Habitat: reef-associated. Saddle toby.  (Vaillant & Sauvage, 1875)  
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Found mostly below depths of 23 m, but occasionally seen in as little as 6 m. Feeds on a wide variety of benthic organisms: gastropods, sponges, algae, bivalves, polychaetes, tunicates, crabs, sea urchins, heart urchins, brittle stars, bryozoans, peanut worms, various small crustaceans and foraminiferans.
  • Randall, J.E. 1985 Guide to Hawaiian reef fishes. Harrowood Books, Newtown Square, PA 19073, USA. 74 p. (Ref. 3921)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Canthigaster coronata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACACGCTGATTTTTCTCAACCAACCATAAAGATATCGGTACCCTCTACCTAGTATTTGGTGCCTGAGCCGGAATAGTAGGAACAGCCCTAAGCCTCCTTATTCGAGCTGAACTTAGCCAACCTGGCGCGCTCTTAGGTGAC---GACCAAATTTATAATGTAATCGTCACAGCCCATGCATTCGTAATAATTTTCTTTATAGTAATGCCAATCATGATCGGTGGCTTTGGAAACTGGCTAGTGCCCCTTATAATCGGGGCACCCGACATGGCATTTCCTCGAATAAATAACATGAGTTTCTGACTATTGCCCCCCTCCTTCCTGCTCCTCCTAGCATCTTCCGGCGTAGAAGCAGGAGCTGGCACAGGCTGAACAGTCTATCCCCCACTAGCAGGCAACCTAGCCCACGCAGGAGCATCTGTTGACCTCACAATTTTCTCCCTCCATTTGGCAGGTGTGTCATCAATCCTGGGCGCTATCAACTTTATTACTACAATTATCAACATAAAACCCCCAGCCATTTCTCAATACCAAACCCCCCTTTTCGTATGGGCCGTTCTAATCACTGCTGTACTACTATTACTGTCCCTGCCAGTTCTCGCAGCCGGAATTACAATACTCCTTACAGACCGAAACCTAAATACCACCTTCTTCGACCCTGCGGGGGGAGGAGACCCCATCCTTTATCAACACCTATTTTGATTCTTTGGCCACCCAGAGGTCTATATTCTCATCCTACCTGGCTTTGGTATAATCTCACACATTGTAGCCTACTACGCCGGTAAGAAAGAACCCTTCGGCTACATGGGCATGGTCTGAGCAATAATGGCCATCGGCCTTTTAGGCTTTATTGTCTGAGCTCACCACATATTCACAGTAGGAATAGACGTTGATACTCGAGCATACTTTACATCCGCCACAATAATTATTGCCATCCCCACCGGTGTAAAAGTATTTAGCTGACTAGCCACCCTACATGGTGGA---TCT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Canthigaster coronata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
  • Miyasaka, A. 1993 A database on scientific and common names of fishes exported from Hawaii. The information was derived from the above mentioned database. A printout of the names is also available from the State of Hawaii, Department of Land and Natural Resources, 1151 Punchbowl Street, Honolulu, Hawaii. (Ref. 5358)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Canthigaster coronata

Canthigaster coronata is a Pufferfish from the Indo-West Pacific. It occasionally makes its way into the aquarium trade. It grows to a size of 14cm in length.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!