Overview

Brief Summary

The striped bass (Morone saxatilis) is a highly prized sportfish, which, although anadromous (meaning it migrates between salt and freshwater) can live its full life in fresh water. They are sleek silver fish that sport dark longitudinal stripes and are also known as Atlantic striped bass, stripers, linesiders, rock, pimpfish, or rockfish. Striped bass are one of six species belonging to the Moronidae family (temperate basses); they are not related to the black basses (which are in the sunfish family Centrarchidae). Striped bass commonly reach a length of 120 cm (3.9 feet), and are thought to live up to 30 years. Native to the Atlantic coastline and drainage waters of North America, the striped bass has been widely introduced to large reservoirs across the United States for recreational fishing, and also for the purpose of controlling populations of non-native gizzard shad (Dorosoma cepedianum). “Stripers” have also been introduced into the pacific coast of North America, and into waters in Ecuador, Iran, Latvia, Mexico, Russia, South Africa, and Turkey. Although their numbers declined in the early 1980s due to overfishing, subsequent management plans and a presidential order signed by George W. Bush in 2007 have returned them to healthy, "not overfished" (according to The Atlantic States Marine Fisheries Commission) status. Striped bass are the state fish of Maryland, Rhode Island, South Carolina, and the state saltwater fish of New York, Virginia, and New Hampshire.

(Wikipedia 2002; Executive order 13449; Shepherd, 2006)

  • Wikipedia, The Free Encyclopedia. 10 January 2012. “Striped bass”. Retrieved January 17, 2012 from http://en.wikipedia.org/w/index.php?title=Striped_bass&oldid=470546569">http://en.wikipedia.org/w/index.php?title=Striped_bass&oldid=470546569">http://en.wikipedia.org/w/index.php?title=Striped_bass&oldid=470546569
  • Executive order 13449, 2007. Protection of Striped Bass and Red Drum Fish Populations. Retrieved January 17, 2012 from http://en.wikisource.org/wiki/Executive_Order_13449">http://en.wikisource.org/wiki/Executive_Order_13449">http://en.wikisource.org/wiki/Executive_Order_13449
  • Shepherd, G. 2006. Atlantic Striped Bass. NOAA National Marine Fisheries Service. Retrieved January 17, 2012 from http://www.nefsc.noaa.gov/sos/spsyn/af/sbass/">http://www.nefsc.noaa.gov/sos/spsyn/af/sbass/">http://www.nefsc.noaa.gov/sos/spsyn/af/sbass/
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: Dana Campbell

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Biology

Inhabit coastal waters and are commonly found in bays but may enter rivers in the spring to spawn (Ref. 2850). Some populations are landlocked (Ref. 7251). Voracious and opportunistic feeder (Ref. 5951). Larvae feed on zooplankton; juveniles take in small shrimps and other crustaceans, annelid worms, and insects (Ref. 1998, 10294); adults feed on a wide variety of fishes (alewives, herring, smelt, eels, flounders, mummichogs, rock gunnels, sand lance, silver hake and silversides (Ref. 5951)) and invertebrates (squid, crabs, sea worms and amphipods (Ref. 5951)), mainly crustaceans (Ref. 1998). Feeding ceases shortly before spawning (Ref. 1998). Utilized fresh and eaten broiled and baked (Ref. 9988).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: This species is native to Atlantic Slope drainages from the St. Lawrence River, Canada, south to the St. Johns River, Florida, and Gulf slope drainages from western Florida (Suwannee River) to Lake Pontchartrain, Louisiana, and apparently to coastal areas of eastern Texas; aside from some remnant populations, native Gulf Coast striped bass no longer occur in the historical range (replaced in some areas by introduced Atlantic Slope fishes). Striped bass has been introduced widely in inland areas of the United States and on the Pacific coast, where it has spread north to British Columbia and south to northern Baja California. It has also been introduced in Eurasia. Sources: Crance (1984), Hill et al. (1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

St. Lawrence River to northern Gulf of Mexico
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

This species is native to Atlantic Slope drainages from the St. Lawrence River, Canada, south to the St. Johns River, Florida, and Gulf slope drainages from western Florida (Suwannee River) to Lake Pontchartrain, Louisiana, and apparently to coastal areas of eastern Texas; aside from some remnant populations, native Gulf Coast striped bass no longer occur in the historical range (replaced in some areas by introduced Atlantic Slope fishes). Striped bass has been introduced widely in inland areas of the United States and on the Pacific coast, where it has spread north to British Columbia and south to northern Baja California. It has also been introduced in Eurasia. Sources: Crance (1984), Hill et al. (1989).

In the Caribbean region Morone saxatilis occurs in the northern Gulf of Mexico and off Florida, USA (get reference, WCA FAO). Depth range??
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: St. Lawrence River in Canada to St. John's River in northern Florida and northern Gulf of Mexico; from fresh and brackish tributaries of western Florida to Louisiana in the USA. Introduced to other countries.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Striped bass can be found on the Atlantic coast of the United States, from northern Florida to the St. Lawrence estuary in southeastern Canada. This species has been introduced to many inland lakes and reservoirs in the Midwest, as well as, the Pacific coast of the United States.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern North America, introduced in western U.S.A. and elsewhere (including Black Sea).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: St. Lawrence River, Canada to St. John?s River, Florida, USA. Gulf of Mexico; in fresh and brackish tributaries of western Florida to Louisiana, USA.
  • Bigelow, H.B. and W.C. Schroeder, 1953; Eschmeyer, W.N., E.S. Herald and H. Hammann, 1983; Heemstra, P.C., 1995; Robins, C.R. and G.C. Ray, 1986; Scott, W.B. and E.J. Crossman, 1973.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9 - 11; Dorsal soft rays (total): 10 - 13; Analspines: 3; Analsoft rays: 7 - 13
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Striped bass have a laterally compressed body, large terminal mouth, separate dorsal fins and six to nine continuous lateral stripes on both sides of its body. The third anal spine is longer and thinner than the second anal spine. Adult striped bass typically weigh 3.6 to 6.8 kg, however, bass exceeding 22 kg are recorded on an annual basis. Adults range in length from 46 to 140 cm. Striped bass tend to be light green, olive, steel blue, black or brown on their dorsum, with a white or silver iridescent venter. Individuals greater than 25 years of age have been recorded, and sexual maturity is attained between the ages of 2 and 4 for males, and between the ages of 5 and 8 for females.

Range mass: 4 to 23 kg.

Range length: 46 to 140 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 200 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 2000 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

200 cm TL (male/unsexed; (Ref. 5723)); max. published weight: 57.0 kg (Ref. 2850); max. reported age: 30 years (Ref. 1468)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

to 200.0 cm TL (male/unsexed); max. weight: 57 kg.
  • Bigelow, H.B. and W.C. Schroeder, 1953; Eschmeyer, W.N., E.S. Herald and H. Hammann, 1983; Heemstra, P.C., 1995; Robins, C.R. and G.C. Ray, 1986; Scott, W.B. and E.J. Crossman, 1973.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Comments: This is a marine and estuarine coastal species that moves far upstream in channels of medium to large rivers during spawning migrations. In coastal areas, it occurs typically within 6 km of shore. Adults in inshore areas occur over a wide range of substrates. The species has been widely introduced in lakes and impoundments. Some populations complete the life cycle in freshwater. In colder months, striped bass tend to seek the warmest water available at depths greater than 1.5 meters.

Striped bass use rivers, tidally influenced fresh waters, and estuaries for spawning and nursery areas. Preferred spawning areas often are shallow (1-20 feet, 0.3-6.1 meters) and turbid and range from the tidal zone to a few hundred kilometers upstream (usually within 38 miles or 60 km of coast). Spawners often seek areas with strong turbulent flow and substrates of rock and/or fine gravel. At Powell Reservoir, Utah, spawning occurred over a rocky shoal in or near the mixing zone of river water and reservoir water.

Eggs are semibuoyant, drift and sink slowly; in riverine populations, current of about 30 cm/sec reportedly is required to keep eggs afloat and prevent death due to settling on bottom (though this may vary with differences in egg buoyancy in different regions). Juveniles apparently prefer clean sandy bottom but have been found over gravel, rock, and (rarely) soft mud; may or may not move to areas of higher salinity in first summer/fall (varies with locality).

See Hill et al. (1989) and Crance (1984) for habitat suitability index model and details on various environmental requirements and tolerances (e.g., temperature, dissolved oxygen, salinity, toxicants).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Anadromous species; found to depths of 30 m in cool bays and rivers.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

benthic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This is a marine and estuarine coastal species that moves far upstream in channels of medium to large rivers during spawning migrations. In coastal areas, it occurs typically within 6 km of shore. Adults in inshore areas occur over a wide range of substrates. The species has been widely introduced in lakes and impoundments. Some populations complete the life cycle in freshwater. In colder months, striped bass tend to seek the warmest water available at depths greater than 1.5 meters.

Striped bass use rivers, tidally influenced fresh waters, and estuaries for spawning and nursery areas. Preferred spawning areas often are shallow (1-20 feet, 0.3-6.1 meters) and turbid and range from the tidal zone to a few hundred kilometers upstream (usually within 38 miles or 60 km of coast). Spawners often seek areas with strong turbulent flow and substrates of rock and/or fine gravel. At Powell Reservoir, Utah, spawning occurred over a rocky shoal in or near the mixing zone of river water and reservoir water.

Eggs are semibuoyant, drift and sink slowly; in riverine populations, current of about 30 cm/sec reportedly is required to keep eggs afloat and prevent death due to settling on bottom (though this may vary with differences in egg buoyancy in different regions). Juveniles apparently prefer clean sandy bottom but have been found over gravel, rock, and (rarely) soft mud; may or may not move to areas of higher salinity in first summer/fall (varies with locality).

See Hill et al. (1989) and Crance (1984) for habitat suitability index model and details on various environmental requirements and tolerances (e.g., temperature, dissolved oxygen, salinity, toxicants).

Morone saxatilis occurs in rivers, estuaries and near shore waters as well as shallow bays, along beaches and in rocky areas. Some populations of M. saxatilis are landlocked in fresh water. This species is anadromous, seasonally migratory and have been successfully introduced in many areas. M saxatilis is a voracious predator that feeds primarily on fishes and invertebrates and feeding ceases right before spawning (Kells and Carpenter 2011). This species is normally gonochoristic, with a rare incidence of hermaphroditic individuals. Males reach maturity at about two years of age and 17cm total length and female at four to six years and 45cm to 55cm total length. The maximum age for M. saxatilis has been estimated to about 30 years. Fecundity estimates range from 15 000 for a 46cm fish to 4 million for a 13 year-old, 14.5kg fish (Heemstra 2002).

[added by Mia: Please add this information]Distribution, movements, and habitat use of small striped bass (Morone saxatilis) across multiple spatial scalesAuthor(s): Able, KW (Able, Kenneth W.)1; Grothues, TM (Grothues, Thomas M.)1; Turnure, JT (Turnure, Jason T.)1; Byrne, DM (Byrne, Donald M.)2; Clerkin, P (Clerkin, Paul)1Source: FISHERY BULLETIN Volume: 110 Issue: 2 Pages: 176-192 Published: APR 2012Times Cited: 0 (from Web of Science)Cited References: 61 [ view related records ] Citation Map Abstract: Distribution, movements, and habitat use of small (<46 cm, juveniles and individuals of unknown maturity) striped bass (Morone saxatilis) were investigated with multiple techniques and at multiple spatial scales (surveys and tag-recapture in the estuary and ocean, and telemetry in the estuary) over multiple years to determine the frequency and duration of use of non-natal estuaries. These unique comparisons suggest, at least in New Jersey, that smaller individuals (<20 cm) may disperse from natal estuaries and arrive in non-natal estuaries early in life and take up residence for several years. During this period of estuarine residence, individuals spend all seasons primarily in the low salinity portions of the estuary. At larger sizes, they then leave these non-natal estuaries to begin coastal migrations with those individuals from nurseries in natal estuaries. These composite observations of frequency and duration of habitat use indicate that non-natal estuaries may provide important habitat for a portion of the striped bass population.

Systems
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; anadromous (Ref. 51243); freshwater; brackish; marine; depth range 30 - ? m (Ref. 2850)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Striped bass thrive in large bodies of deep, clear water. Ideal temperatures range from 18.3 to 21.1 °C, and evidence suggests a lower temperature limit of 9.0 °C. Mature fish can be found living inshore, in estuaries, and in freshwater habitats, depending on season and location, and most individuals are found more within five miles from the coast. Juvenile fish are normally found in rivers, which provide critical habitat for spawning.

Habitat Regions: saltwater or marine ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams; coastal ; brackish water

Other Habitat Features: estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 362 specimens in 1 taxon.
Water temperature and chemistry ranges based on 155 samples.

Environmental ranges
  Depth range (m): 0 - 96.5
  Temperature range (°C): 6.405 - 21.296
  Nitrate (umol/L): 0.663 - 11.522
  Salinity (PPS): 32.397 - 34.903
  Oxygen (ml/l): 5.020 - 6.835
  Phosphate (umol/l): 0.221 - 1.027
  Silicate (umol/l): 1.848 - 7.988

Graphical representation

Depth range (m): 0 - 96.5

Temperature range (°C): 6.405 - 21.296

Nitrate (umol/L): 0.663 - 11.522

Salinity (PPS): 32.397 - 34.903

Oxygen (ml/l): 5.020 - 6.835

Phosphate (umol/l): 0.221 - 1.027

Silicate (umol/l): 1.848 - 7.988
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Demersal; freshwater; brackish; marine; depth range to 30 m. Commonly found in bays and coastal waters. May enter rivers to spawn in spring. Some populations are landlocked.
  • Bigelow, H.B. and W.C. Schroeder, 1953; Eschmeyer, W.N., E.S. Herald and H. Hammann, 1983; Heemstra, P.C., 1995; Robins, C.R. and G.C. Ray, 1986; Scott, W.B. and E.J. Crossman, 1973.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Certain stocks along the Atlantic coast north of Cape Hatteras may make extensive migrations along the coast, moving north in spring and south in fall (extent of migration varies among individuals and populations). Individuals may ascend rivers as far as 200 miles (320 km) during spawning migrations (usually only 25 miles [40 km] or less). Populations along the South Atlantic coast of the U.S. apparently do not make extensive coastal migrations that are typical of stocks in the Middle and North Atlantic regions. See Hill et al. (1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Anadromous. Fish that ascend rivers to spawn, as salmon and hilsa do. Sub-division of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Larvae feed on zooplankton (e.g. Copepoda, Cladocera), young primarily consume zooplankton & other invertebrates (e.g. Copedoda, Cladocera, Amphipoda, mysids); adults are predatory on fishes and larger crustaceans (Hassler 1988). When available, threadfin shad or gizzard shad often the major food for adults. Within the above categories, striped bass are basically opportunistic feeders.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Inhabits coastal waters and are commonly found in bays but may enter rivers in the spring to spawn (Ref. 2850). Coastal schooling species and anadromous (Ref. 5951); some populations are landlocked (Ref. 7251). Larvae feed on zooplankton; juveniles take in small shrimps and other crustaceans, annelid worms, and insects; adults feed on a wide variety of fishes and invertebrates, mainly crustaceans (Ref. 1998). Feeding ceases shortly before spawning (Ref. 1998). Juveniles are preyed upon by Atlantic tomcod, Atlantic cod, silver hake and larger striped bass.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

The dietary habits of striped bass change throughout their life. As larvae, striped bass feed on zooplankton, and as juveniles they mostly feed on insect larvae, small crustaceans, mayflies, and larval fish. Adult striped bass are piscivorous, feeding on bay anchovy, Atlantic silversides and yellow perch; however, a vast majority of their diet consists of Atlantic menhaden. Striped bass do most of their feeding at night in benthic habitats, but chase prey to the water's surface when necessary, typically during fall when trying to build winter fat reserves.

Animal Foods: fish; insects; mollusks; aquatic crustaceans; other marine invertebrates; zooplankton

Primary Diet: carnivore (Piscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Zooplankton, fishes and invertebrates, mainly crustaceans. Juveniles feed on small shrimps, other crustaceans, annelid worms, and insects. Fish stop feeding shortly before spawning.
  • Bigelow, H.B. and W.C. Schroeder, 1953; Eschmeyer, W.N., E.S. Herald and H. Hammann, 1983; Heemstra, P.C., 1995; Robins, C.R. and G.C. Ray, 1986; Scott, W.B. and E.J. Crossman, 1973.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Striped bass are important predators on Atlantic menhaden and help maintain prey populations at sustainable levels. Major parasites of striped bass include copepods (e.g., Ergasilus labracid), tapeworms, cestode worms (e.g., Proteocephalid larvae), protists (e.g., Colponema, Trichodina, and Glossatella), myxozoans (e.g., Myxosoma morone), roundworms (e.g., Philometra rubra), and spiny-headed worms (e.g., Pomphorhynchus rocci larvae). For a complete account of parasites specific to this species, please reference Paperna and Zwerner (1976).

Ecosystem Impact: keystone species

Commensal/Parasitic Species:

  • Paperna, I., D. Zwerner. 1982. Host-parasite relationship of Ergasilus labracid Krøyer (Cyclopidea, Ergasilidae) and the striped bass, Morone saxatilis (Walbaum) from the lower Chesapeake Bay.. Ann Parasitol Hum Comp, 57/4: 393-405.
  • Paperna, I., D. Zwerner. 1976. Parasites and diseases of striped bass, Morone saxatilk (Walbaum), from the lower Chesapeake Bay. Journal of Fish Biology, 9: 267-287.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

With the exception of humans, seals, and sharks, adult striped bass have few natural predators. Juveniles, however, are preyed upon by many larger fish, such as Atlantic tomcod, Atlantic cod, bluefish, silver hake, and larger striped bass have been known consume juveniles as well.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Morone saxatilis is prey of:
Homo sapiens

Based on studies in:
USA: California (Estuarine, Intertidal, Littoral)
USA: Rhode Island (Coastal)

This list may not be complete but is based on published studies.
  • G. E. MacGinitie, Ecological aspects of a California marine estuary, Am. Midland Nat. 16(5):629-765, from p. 652 (1935).
  • J. N. Kremer and S. W. Nixon, A Coastal Marine Ecosystem: Simulation and Analysis, Vol. 24 of Ecol. Studies (Springer-Verlag, Berlin, 1978), from p. 12.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Morone saxatilis preys on:
Grapsidae
Scorpaenichthys marmoratus
Ethmidium maculatum
Oncorhynchus tshawytscha
Lepomis macrochirus

Based on studies in:
USA: California (Estuarine, Intertidal, Littoral)
USA: Rhode Island (Coastal)

This list may not be complete but is based on published studies.
  • G. E. MacGinitie, Ecological aspects of a California marine estuary, Am. Midland Nat. 16(5):629-765, from p. 652 (1935).
  • J. N. Kremer and S. W. Nixon, A Coastal Marine Ecosystem: Simulation and Analysis, Vol. 24 of Ecol. Studies (Springer-Verlag, Berlin, 1978), from p. 12.
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Edwardsiellosis. Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Gregarious. Year-class success appears to be determined during fist 2 months of life, may be correlated with environmental conditions during larval stages (Hill et al. 1989). Growth and development rates vary widely, depending on conditions. Parasitic infection rarely cause mortalities in wild populations unless fishes are under stress (Hill et al. 1989). Summer die-offs are common in reservoirs (Sublette et al. 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

Larvae feed on zooplankton, juvenile diet consists of small shrimp and other crustaceans, annelid worms and insects, adults prefer a variety of fishes and invertebraes, mainly crustaceans
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Sensory perception in striped bass occurs via the lateral line, a keen sense of smell and marginal vision. The lateral line gives them the ability to detect sound waves, as well as information related velocity and pressure. It also allows them to sense vibrations which is useful in predation and predator avoidance. Striped bass possess an acute sense of smell, which helps guide them to natal spawning grounds as well as detect potential prey. While striped bass have marginal vision, the number of rods and cones in their retinas allow for vision similar to that in humans. Rods allow them to see in low light conditions whereas cones make color vision possible. Vision is primarily used during close encounters with prey.

Communication Channels: visual

Perception Channels: visual ; acoustic ; vibrations

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Move into fresh or brackish water to spawn (Ref. 39467). Females spawn more than once in a season, but they don't necessarily spawn every year (Ref. 1998).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Development

Striped bass eggs hatch 29 to 80 hours after fertilization. Newly hatched larvae remain suspended in the water column and tend to suffocate if they spend and extended period of time in oxygen poor water. Larvae measure about 3.1 mm long. As larvae, nourishment comes from the large yolk mass the females released with her eggs, and after two to four days their mouth forms. Once larvae begin feeding, primary prey consists of microscopic organisms that occupy the same area of water column. Juveniles are highly sensitive to their environment and can be greatly affected by changes in temperature or salinity. About 1 week after hatching, juveniles begin feeding on small crustaceans, such as copepods. Once they reach about 2 inches in length, juveniles begin feeding primarily on mysid shrimp and amphipods. During their first year of life, striped bass reach anywhere from 10 to 12 inches in length. Males reach sexual maturity by 3 years of age, and females reach sexual maturity within 4 to 6 years of age. Striped bass can live for up to 20 years in the wild.

Development - Life Cycle: indeterminate growth

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Most striped bass live between 10 and 12 years; however, individuals older than 30 years have been recorded in the wild.

Range lifespan

Status: wild:
10 to 30 years.

Typical lifespan

Status: wild:
10 to 12 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 30 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Spawning occurs as early as mid-February in Florida, as late as June-July in the St. Lawrence River; see Hill et al. (1989) for more detail on specific areas, and Crance (1984) for spawning in relation to temperature in various areas. Eggs hatch in about 2-3 days. Males usually become sexually mature in 1-3 years, females in 4-6 years (Middle Atlantic region). Spawning occurs in large aggregations (Moyle 1976).

See Hassler (1988) for a review of life history in Sacramento-San Joaquin Delta, California. See also Crance (1984).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Morone saxatilis is polyandrous. A group of 7 to 8 males surround a single larger female, and once surrounded, males bump the female to the waters surface. This act is often referred to as “rock fights,” due to the splashing that occurs on the surface of the water. Once at the surface, males continue bumping the female until she releases her eggs into the water. Once the eggs are discharged into the water, males release their sperm.

Mating System: polyandrous

Striped bass begin spawning when temperatures warm to about 18 degrees C. They tend to spawn in rivers and in brackish estuaries. Major spawning locations include the Hudson River, the Chesapeake Bay and the Roanoke River-Albermarle Sound watershed. Once fertilized, embryos drift in the current for 1.5 to 3 days. Female can release between 500,000 and 3 million eggs during a single spawning event; however, less than one percent of embryos survive for more than a couple of months after hatching. Male striped bass typically reach sexual maturity at 2 to 3 years of age, and females reach sexual maturity at 5 to 6 years of age.

Breeding interval: Striped bass spawn once a year.

Breeding season: Striped bass spawn once a year, from April to mid-June.

Range number of offspring: 500,000 to 3,000,000.

Range time to hatching: 1.5 to 3 days.

Range age at sexual or reproductive maturity (female): 5 to 6 years.

Range age at sexual or reproductive maturity (male): 2 to 3 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); broadcast (group) spawning; oviparous

Striped bass are broadcast spawners and embryos developed while suspended in the water column. As a result, parental care is nonexistent in this species.

Parental Investment: no parental involvement

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Bass spawn either in brackish water at the heads of estuaries or in fresh rivers from late April to early May in North Carolina. Spawning occurs in May, in the Chesapeake Bay region; and perhaps in the waters of New York. Fish probably spawn June in the rivers of Massachusetts, of Maine, and of the Bay of Fundy, but in June and July in the southern shore of the Gulf of St. Lawrence and of the lower St. Lawrence River. When deposited in the water, eggs average 1.1 to1.35 mm in diameter. Within the first few hours after fertilization, however, the perviteline membrance swells to an average diameter of about 3.6 mm. Eggs hatch after 70 to 74 hours at water temperatures of 58 to 60 °C; after 48 hours at 67 °C; and after 30 hours at 71to 72 °C.
  • Bigelow, H.B. and W.C. Schroeder, 1953; Eschmeyer, W.N., E.S. Herald and H. Hammann, 1983; Heemstra, P.C., 1995; Robins, C.R. and G.C. Ray, 1986; Scott, W.B. and E.J. Crossman, 1973.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Morone saxatilis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 26
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Morone saxatilis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATATCTAGTATTTGGCGCTTGAGCTGGTATAGTGGGCACTGCTTTAAGCCTCCTTATTCGAGCAGAGCTAAGCCAACCGGGCGCCCTCCTTGGGGATGACCAGATCTACAATGTAATCGTTACCGCACATGCATTTGTAATGATTTTTTTTATAGTAATGCCAATTATGATTGGAGGGTTTGGGAATTGACTAATTCCTCTAATGATCGGGGCGCCAGATATGGCATTTCCCCGAATGAACAACATAAGTTTTTGACTGCTTCCCCCATCCTTCCTCCTCCTTCTAGCTTCTTCAGGTGTCGAAGCCGGGGCTGGAACTGGCTGAACCGTTTACCCCCCTCTTGCAAGCAACCTTGCACATGCAGGAGCATCTGTAGACCTAACAATTTTCTCCCTCCACCTAGCCGGGATCTCCTCGATTTTAGGAGCCATTAATTTCATCACAACTATTATTAACATGAAGCCTCCTGCCATCTCCCAATATCAGACCCCTTTATTTGTCTGAGCAGTTCTAATTACAGCCGTCCTTTTGCTTCTTTCTCTCCCAGTCCTTGCAGCCGGAATTACTATGTTACTCACAGACCGAAATCTAAACACTACCTTCTTCGACCCTGCGGGAGGAGGGGACCCCATCCTCTACCAACACCTTTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N2 - Imperiled

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
NatureServe

Reviewer/s
Smith, K. & Darwall, W.R.T.

Contributor/s

Justification
Listed as Least Concern in view of the large extent of occurrence, large number of subpopulations, large population size, and lack of major threats. Trend over the past 10 years or three generations is uncertain but likely relatively stable, or the species may be declining but not fast enough to qualify for any of the threatened categories under Criterion A (reduction in population size).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Although this species has not been evaluated by the International Union for Conservation of Nature (IUCN), landing totals over the last 20 years have exhibited significant decreases in abundance. One of the primary conservation efforts for this species is the Interstate Fishery Management Plan for Atlantic Striped Bass, developed by the Atlantic States Marine Fisheries Commission under the authority of the Striped Bass Conservation Act. Under the conservation and management directives of this plan, striped bass populations have made the biggest comeback of any finfish species on record, with estimates as high as 1 to 1.5 million in the Connecticut River every spring. Despite their rebound, striped bass face a number of challenges. For example, mycobacteriosis, a bacterial infection that results in skin lesions, stunted growth, inflammation, tissue destruction, and formation of scare tissue in organs, poses a significant threat to the overall health of this species. Unfortunately, little is known of this disease, and research is currently underway to investigate this pathogen and its impact on the species as a whole.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is represented by a large number of subpopulations and locations. Total adult population size is unknown but relatively large.

Population in Sacramento-San Joaquin Delta has declined steadily since 1960s (Hassler 1988). Chesapeake Bay population has recovered from large declines that extended through the 1970s (Baker 1994).

Morone saxatilis populations have declined in recent years (Heemstra 2002).

Caribbean: Little population information is available. [check this]

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Comments: Decline in Sacramento-San Joaquin Delta is attributed primarily to toxic substances and to entrainment of young in water diversion structures (Hassler 1988). Habitat destruction affected populations in Hudson River, Chesapeake Bay, and Albemarle Sound, resulting in drastic declines in mid-20th century (Hill et al. 1989). Excess harvest contributed the decline along the U.S. east coast in the late 1970s and early 1980s; hatchery production and restrictions on the harvest resulted in population increases in the Chesapeake Bay region by the early 1990s (Diamond 1990). Alterations in habitat quality have eliminated native bass populations from most of original range along Gulf of Mexico; but populations increasing due to stocking (Hill et al. 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
Declines in Sacramento-San Joaquin Delta (where introduced) is attributed primarily to toxic substances and to entrainment of young in water diversion structures (Hassler 1988). Habitat destruction affected populations in Hudson River, Chesapeake Bay, and Albemarle Sound, resulting in drastic declines in mid-20th century (Hill et al. 1989). Excess harvest contributed the decline along the U.S. east coast in the late 1970s and early 1980s; hatchery production and restrictions on the harvest resulted in population increases in the Chesapeake Bay region by the early 1990s (Diamond 1990).

Caribbean: Alterations in habitat quality have eliminated native bass populations from most of original range along Gulf of Mexico; but populations increasing due to stocking (Hill et al. 1989).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Management Requirements: See Harrell et al. (1990) for information on culture and propagation methods.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation Actions

Conservation Actions
Currently, this species is of relatively low conservation concern and does not require significant additional protection or major management, monitoring, or research action.

The are commercial and recreational limits for Morone saxatilis are managed by state jurisdictions (Maryland Department of Natural Resources 2012, Virginia Marine Resources Commission 2012).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Uses

Comments: Formerly large commercial catches have declined in many areas along the Atlantic coast; major commercial fishery continues in Albemarle Sound (Hill et al. 1989). Commercial landings along the U.S. east coast were 8-14 million pounds/year from 1960 to 1970, up to 14.7 million pounds in 1973, down to 3.5 million pounds by 1979 (Diamond 1990). Most major South Atlantic coastal rivers support a recreational fishery (Hill et al. 1989). Propagation and management of striped bass in inland waters followed discovery of reproducing land-locked population in Santee-Cooper Reservoir in South Carolina. The wiper, a striped bass-white bass hybrid, is extensively cultured in U.S. Important sport fish in Sacramento-San Joaquin Delta, California (see Hassler 1988), and in certain areas along Atlantic coast.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Importance

fisheries: minor commercial; aquaculture: commercial; gamefish: yes; price category: medium; price reliability: reliable: based on ex-vessel price for this species
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

Striped bass introduced into the California Delta prey upon salmon and delta smelt and are now considered an invasive species. Salmon and delta smelt are important prey for a number of piscivorous fish species, which have experienced significant declines since the introduction of striped bass.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Striped bass are one of the most highly sought after sport fish along the Atlantic coast of the United States. Many fishermen take note of the migratory patterns of these fish and use this knowledge to catch them during different parts of the year, especially spring, when the fish are on their way to their natal spawning grounds. In addition to recreational fishing, a major commercial fishery for striped bass exists off the coast of Virginia and Maryland, which has accounted for nearly 56% of total catch since the year 2000. In 1974, commercial landings totaled 6,000 megatons. Due to severe population declines, these numbers have decreased dramatically, and in 2004, commercial landings totaled 3,290 mega tons.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Striped bass

"Striper" redirects here. For other uses, see Stripe (disambiguation).

The striped bass (Morone saxatilis), also called Atlantic striped bass, striper, linesider, rock, or rockfish, is the state fish of Maryland, Rhode Island, South Carolina, and the state saltwater (marine) fish of New York, New Jersey, Virginia, and New Hampshire. They are also found in the Minas Basin and Gaspereau River in Nova Scotia, Canada and the Miramichi River and Saint John River in New Brunswick, Canada.

Morphology and lifespan[edit]

The striped bass is a typical member of the Moronidae family in shape, having a streamlined, silvery body marked with longitudinal dark stripes running from behind the gills to the base of the tail. The maximum scientifically recorded weight is 57 kg (125 lb). Common mature size is 120 cm (3.9 ft). Striped bass are believed to live for up to 30 years.[1] The maximum length is 1.8 m (6 ft).[2] The average size is about 67–100 cm (2.2-3.3 ft) and 4.5-14.5 kg (10-32 lb).

Distribution[edit]

Researcher holds up a large striped bass

Natural distribution[edit]

Striped bass are native to the Atlantic coastline of North America from the St. Lawrence River into the Gulf of Mexico to approximately Louisiana. They are anadromous fish that migrate between fresh and salt water. Spawning takes place in fresh water.

Introductions outside their natural range[edit]

Striped bass have been introduced to the Pacific Coast of North America and into many of the large reservoir impoundments across the United States by state game and fish commissions for the purposes of recreational fishing and as a predator to control populations of gizzard shad.[3][4][5] These include: Elephant Butte Lake in New Mexico; Lake Ouachita, Lake Norman in North Carolina, Lake Norfork, Beaver Lake and Lake Hamilton in Arkansas; Lake Powell, Putnam Illinois (Lake Thunderbird) Lake Pleasant, and Lake Havasu in Arizona; Castaic Lake and Lake George in Florida, Pyramid Lake, Silverwood Lake, Diamond Valley Lake, Lewis Smith Lake in Alabama [1], Lake Cumberland in Kentucky , and Lake Murray in South Carolina; Lake Lanier in Georgia; Watts Bar Lake, Tennessee; and Lake Mead, Nevada; Lake Texoma, Lake Tawakoni, Lake Whitney, Possum Kingdom Lake, and Lake Buchanan in Texas; Raystown Lake in Pennsylvania; and in Virginia's Smith Mountain Lake[6] and Leesville Lake.[7]

Striped bass have also been introduced into waters in Ecuador, Iran, Latvia, Mexico, Russia, South Africa, and Turkey, primarily for sport fishing and aquaculture.[1]

Environmental factors[edit]

The spawning success of striped bass has been studied in the San Francisco Bay-Delta water system, with a finding that high total dissolved solids (TDS) reduce spawning. At levels as low as 200 mg/l TDS, an observable diminution of spawning productivity occurs.[8] They can be found in lakes, ponds, streams, and wetlands.

In the United States, the striped bass was designated as a protected game fish in 2007, and executive agencies were directed to use existing legal authorities to prohibit the sale of striped bass caught in federal waters in the Atlantic Ocean and Gulf of Mexico.[9]

In Canada, the province of Quebec designated the striped bass population of the Saint Lawrence as extirpated in 1996. Analysis of available data implicated overfishing and dredging in the disappearance. In 2002, a successful reintroduction program was introduced.[10][11]

Life cycle[edit]

Illustration of a group of striped bass

Striped bass spawn in fresh water, and although they have been successfully adapted to freshwater habitat, they naturally spend their adult lives in saltwater (i.e., it is anadromous). Four important bodies of water with breeding stocks of striped bass are: Chesapeake Bay, Massachusetts Bay/Cape Cod, Hudson River and Delaware River. It is believed that many of the rivers and tributaries that emptied into the Atlantic, had at one time, breeding stock of striped bass. One of the largest breeding areas is the Chesapeake Bay, where populations from Chesapeake and Delaware bays have intermingled.[12] The very few successful spawning populations of freshwater striped bass include Lake Texoma, the Colorado River and its reservoirs downstream from and including Lake Powell, and the Arkansas River, as well as Lake Marion (South Carolina) that retained a landlocked breeding population when the dam was built; other freshwater fisheries must be restocked with hatchery-produced fish annually. Stocking of striped bass was discontinued at Lake Mead in 1973 once natural reproduction was verified.[13]

Hybrids with other bass[edit]

Striped bass have also been hybridized with white bass to produce hybrid striped bass also known as wiper, whiterock bass, sunshine bass, and Cherokee bass. These hybrids have been stocked in many freshwater areas across the US.[14][15]

Fishing for striped bass[edit]

Main article: Striped bass fishing
Striped bass caught in the Atlantic Ocean off the New Jersey coast

Striped bass are of significant value for sport fishing, and have been introduced to many waterways outside their natural range. A variety of angling methods are used, including trolling and surf casting, with topwater lures a good pick for surf casting. Striped bass will take a number of live and fresh baits, including bunker, clams, eels, sandworms, herring, bloodworms, mackerel, and shad, with the last being an excellent bait for freshwater fishing.

The largest striped bass ever taken by angling was an 81.88-lb (37.14-kg) specimen taken from a boat in Long Island Sound, near the Outer Southwest Reef, off the coast of Westbrook, Connecticut. The all-tackle world record fish was taken by Gregory Myerson[16] on the night of August 4, 2011. The fish took a drifted live eel bait, and fought for 20 minutes before being boated by Myerson. A second hook and leader was discovered in the fish's mouth when it was boated, indicating it had been previously hooked by another angler. The fish measured 54 in length and had a girth of 36 in. The International Game Fish Association declared Myerson's catch the new all-tackle world record striped bass on October 19, 2011.[17] In addition to now holding the All-Tackle record, Meyerson’s catch also landed him the new IGFA men’s 37-kg (80-lb) line class record for striped bass, which previously stood at 70 lb. The previous all-tackle world record fish was a 78.5-lb (35.6-kg) specimen taken in Atlantic City, New Jersey on September 21, 1982[18] by Albert McReynolds, who fought the fish from the beach for 1:20 after it took his Rebel artificial lure. McReynolds' all-tackle world record stood for 29 years.[19]

Recreational bag limits vary by state and province.

Landlocked striped bass[edit]

Striped bass are an anadromous fish, so their spawning ritual of traveling up rivers to spawn led some of them to become landlocked during lake dam constructions. The first area where they became landlocked was documented to be in the Santee-Cooper River during the construction of the two dams that impounded Lakes Moultrie and Marion, and because of this, the state game fish of South Carolina is the striped bass.[20]

Recently, biologists came to believe that striped bass stayed in rivers for long periods of time, with some not returning to sea unless temperature changes forced migration. Once fishermen and biologists caught on to rising striped bass populations, many state natural resources departments started stocking striped bass in local lakes. Striped bass still continue the natural spawn run in freshwater lakes, traveling up river and blocked at the next dam, which is why they are landlocked. Landlocked stripers have a hard time reproducing naturally, and one of the few and most successful rivers they have been documented reproducing successfully is the Coosa River in Alabama and Georgia.[21]

A 70.6-lb (32.0-kg) landlocked bass was caught in February 2013 by James Bramlett on the Warrior River in Alabama, a current world record.[22] This fish had a length of 44 inches (112 cm) and a girth of 37.75 inches (96 cm).

One of the only landlocked striped bass populations in Canada is located in the Grand Lake, Nova Scotia. They migrate out in early April into the Shubencadie River to spawn. These bass also spawn in the Stewiacke River (a tributary of the Shubencadie ). The Shubencadie River system is one of five known spawning areas in Canada for striped bass, with the others being the St. Lawerence River, Miramichi River, Saint John River, Annapolis River and Shubencadie/Stewiacke Rivers. http://www.dfo-mpo.gc.ca/species-especes/species-especes/stripedbass-Fundy-barraye-eng.htm

Management[edit]

The striped bass population declined to less than 5 million by 1982, but efforts by fishermen and management programs to rebuild the stock proved successful, and in 2007, there were nearly 56 million fish, including all ages. Recreational anglers and commercial fisherman caught an unprecedented 3.8 million fish in 2006. The management of the species includes size limits, commercial quotas, and biological reference points for the health of the species. The Atlantic States Marine Fisheries Commission states that striped bass are "not overfished and overfishing is not occurring."[23]

References[edit]

  1. ^ a b Froese, Rainer and Pauly, Daniel, eds. (2007). "Morone saxatilis" in FishBase. March 2007 version.
  2. ^ National Audubon Society (May 2001). National Audubon Society Field Guide to North American Fishes. Knopf, Rev Sub edition (May 21, 2002). ISBN 0375412247. 
  3. ^ Striped Bass Management Plan retrieved on 10 June 2007.
  4. ^ Pennsylvania State Fish & Boat Commission, Gallery of Pennsylvania Fishes, Chapter 21. Retrieved 10 June 2007.
  5. ^ Indiana Fish and Wildlife, Evaluation of Striped Bass Stockings at Harden Reservoir. Retrieved 10 June 2007.
  6. ^ http://www.dgif.virginia.gov/fishing/waterbodies/display.asp?id=122
  7. ^ http://www.dgif.virginia.gov/fishing/waterbodies/display.asp?id=77
  8. ^ Kaiser Engineers, California, Final Report to the State of California, San Francisco Bay-Delta Water Quality Control Program, State of California, Sacramento, CA (1969)
  9. ^ "Executive Order 13449: Protection of Striped Bass and Red Drum Fish Populations". Office of the Federal Register. October 20, 2007. Retrieved October 24, 2007. 
  10. ^ "Reintroduction of the striped bass into the St. Lawrence" (2nd ed.). Minister of the Environment. 2008. Retrieved May 12, 2014. 
  11. ^ "Reproduction of striped bass - A historical first: spawning ground identified in Montmagny". Gouvernement du Québec, 2003-2012. September 1, 2011. Retrieved May 12, 2014. 
  12. ^ Chesapeake Bay Program, Striped Bass
  13. ^ Wilde, G. R. and L.J. Paulson. 1989. Food habits of subadult striped bass in Lake Mead Arizona-Nevada. The Southwestern Naturalist 34(1) 118-123.
  14. ^ Illinois Department of Natural Resources, Status of the Striped Bass/Hybrid Bass Bass Fishery March 2006 retrieved 10 June 2007.
  15. ^ Pennsylvania State Fish & Boat Commission, Gallery of Pennsylvania Fishes, Chapter 21. Retrieved 10 June 2007.
  16. ^ Greg Myerson's World Record Striper Official Website
  17. ^ IGFA all-tackle world record striped bass
  18. ^ New Jersey Division of Fish and Wildlife
  19. ^ David DiBendetto, On The Run, An Angler's Journey Down the Striper Coast, page 195
  20. ^ "History of Freshwater Striped Bass". Retrieved 2010-03-01. 
  21. ^ "Striped Bass in River Systems". Retrieved 2010-03-01. 
  22. ^ "Word Record Landlocked Bass". Retrieved 2013-05-21. 
  23. ^ "Atlantic States Marine Fisheries Commission: Striped Bass". Retrieved 2009-07-02. 

Other references[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 1 person

Average rating: 4.0 of 5

Names and Taxonomy

Taxonomy

Comments: Formerly placed in the genus Roccus. Distinct populations occur within Chesapeake Bay and in other areas (Chapman 1990). Wirgin et al. (1989) found unique mtDNA genotypes in the Apalachicola River system, suggesting the continued existence there of a maternal lineage of Gulf ancestry. The family Percichthyidae was recognized by Robins et al. (1991) as possibly polyphyletic but was retained for convenience.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!