Overview

Comprehensive Description

Biology

Adults inhabit sand and mud bottoms (Ref. 4925). Young occur in intertidal areas. Feed on small crustaceans, marine worms, brittle stars and small mollusks (Ref. 6885). Spawning adults make extensive migrations (Ref. 6885).
  • Cooper, J.A. and F. Chapleau 1998 Monophyly and intrarelationships of the family Pleuronectidae (Pleuronectiformes), with a revised classification. Fish. Bull. 96(4):686-726. (Ref. 30193)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern North Pacific as far west as Agattu Island, Aleutian Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific: Bering Sea to Bahia San Cristobal, central Baja California, Mexico (Ref. 27436). Hybridizes with Platichthys stellatus - the hybrid, called Inopsetta ischyra, may be found from the Bering Sea to San Francisco, California, USA.
  • Eschmeyer, W.N., E.S. Herald and H. Hammann 1983 A field guide to Pacific coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 336 p. (Ref. 2850)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 72 - 92; Analspines: 0; Analsoft rays: 45 - 70; Vertebrae: 41 - 44
  • Hart, J.L. 1973 Pacific fishes of Canada. Bull. Fish. Res. Board Can. 180:740 p. (Ref. 6885)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Max. size

49.0 cm TL (male/unsexed; (Ref. 6885)); 57 cm TL (female); max. published weight: 1,500 g (Ref. 56527); max. reported age: 22 years (Ref. 55701)
  • Hart, J.L. 1973 Pacific fishes of Canada. Bull. Fish. Res. Board Can. 180:740 p. (Ref. 6885)
  • Fadeev, N.S. 2005 Guide to biology and fisheries of fishes of the North Pacific Ocean. Vladivostok, TINRO-Center. 366 p. (Ref. 56527)
  • Munk, K.M. 2001 Maximum ages of groundfishes in waters off Alaska and British Columbia and consideration of age determination. Alaska Fish. Res. Bull. 8(1):12-21. (Ref. 55701)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 490 mm ---
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Dorsal origin above middle of upper eye. Pectorals inclined to be pointed.
  • Hart, J.L. 1973 Pacific fishes of Canada. Bull. Fish. Res. Board Can. 180:740 p. (Ref. 6885)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Parophrys vetulus
Catalog Number: USNM 4482
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Locality: San Francisco, San Francisco County, California, United States, Pacific
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 549m.
Recorded at 549 meters.

Habitat: demersal. Inhabits sand and mud bottoms (Ref. 4925). Young occur in intertidal areas. Feeds on small crabs and shrimps, worms, brittlestars, clams and clam siphons, and other small molluscs (Ref. 4925). Makes extensive migrations (Ref. 6885). Females 44 cm in length produce as much as 1,900,000 eggs (Ref. 6885). Eggs are pelagic but sink before hatching (Ref. 6885). Interbreeds with the @Platichthys stellatus@ (Ref. 2850).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; oceanodromous (Ref. 51243); marine; depth range 0 - 550 m (Ref. 6793)
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
  • Allen, M.J. and G.B. Smith 1988 Atlas and zoogeography of common fishes in the Bering Sea and northeastern Pacific. NOAA Tech. Rep. NMFS 66, 151 p. (Ref. 6793)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 2115 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1040 samples.

Environmental ranges
  Depth range (m): 0.455 - 402.5
  Temperature range (°C): 6.451 - 11.144
  Nitrate (umol/L): 4.675 - 34.487
  Salinity (PPS): 31.561 - 34.190
  Oxygen (ml/l): 1.139 - 6.583
  Phosphate (umol/l): 0.800 - 2.732
  Silicate (umol/l): 14.037 - 56.571

Graphical representation

Depth range (m): 0.455 - 402.5

Temperature range (°C): 6.451 - 11.144

Nitrate (umol/L): 4.675 - 34.487

Salinity (PPS): 31.561 - 34.190

Oxygen (ml/l): 1.139 - 6.583

Phosphate (umol/l): 0.800 - 2.732

Silicate (umol/l): 14.037 - 56.571
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Parophrys vetulus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 34 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTGGCACCCTCTATCTCGTATTTGGTGCCTGAGCCGGAATAGTGGGGACAGGCTTAAGCCTGCTCATTCGGGCAGAACTTAGCCAACCTGGGGCTCTCCTGGGAGACGACCAAATTTATAACGTAATCGTCACCGCACACGCCTTTGTAATAATTTTCTTTATAGTAATGCCAATTATGATCGGAGGGTTCGGAAACTGACTTATTCCACTAATAATTGGGGCCCCCGATATGGCCTTCCCTCGAATAAATAACATGAGTTTCTGACTTCTACCCCCATCCTTTCTCCTTCTTCTAGCCTCTTCAGGGGTTGAAGCTGGGGCAGGAACAGGGTGAACCGTGTATCCCCCACTAGCTGGGAATCTAGCACACGCCGGAGCGTCCGTAGACCTCACAATCTTTTCCCTTCACCTTGCCGGAATTTCATCAATTCTAGGAGCAATCAACTTTATTACTACCATCATCAACATGAAACCGACAGCAGTCACTATGTACCAAATCCCACTATTTGTTTGAGCCGTACTCATTACTGCCGTCCTTCTCCTCCTTTCCCTACCCGTCTTAGCCGCTGGCATTACAATGCTACTCACAGACCGCAACCTAAACACAACCTTCTTTGACCCTGCCGGAGGAGGTGACCCCATCCTTTACCAACACCTATTCTGATTCTTCGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Parophrys vetulus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 28
Specimens with Barcodes: 36
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; gamefish: yes
  • Newman, L. 1995 Census of fish at the Vancouver aquarium, 1994. Unpublished manuscript. (Ref. 9183)
  • Canadian Department of Fisheries and Oceans 1995 British Columbia tidal waters sport fishing guide 1995-1996. Canadian Dept. of Fisheries and Oceans. (Ref. 11007)
  • Clemens, W.A. and G.V. Wilby 1961 Fishes of the Pacific coast of Canada. 2nd ed. Fish. Res. Bd. Canada Bull. (68):443 p. (Ref. 4925)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

English sole

The English sole, Parophrys vetulus, is a flatfish of the family Pleuronectidae. It is a demersal fish that lives on sandy and muddy bottoms in estuaries and near shore areas, at depths of up to 550 metres (1,800 ft). It reaches up to 57 centimetres (22 in) in length, and can weigh up to 1.5 kilograms (3.3 lb). Its native habitat is the Eastern Pacific, stretching from the coast of Baja California in the south to the Bering Sea in the north.[1][2]

English sole is an important commercial fish, primarily caught off Washington, Oregon and California. Though biomass is increasing, catches have been declining since the 1960s and are currently almost at an all-time low.[3]

The English sole is known in Spanish as platija limón, or lemon sole, a name by which it is also known in English,[3][4] though the true lemon sole is a separate species, Microstomus kitt.

Contents

Etymology

The genus name is derived from the Greek para, meaning "near", ophrys, meaning "eyebrow", and the species name vetulus is a word meaning "old man".[5]

Description

The English sole is a right-eyed flatfish with a compressed, diamond-shaped body and a small head with a pointed snout and small, asymmetric mouth. The upper surface is covered in rough scales and is usually uniformly brown, but occasionally speckled; the lower surface is smooth, and white to pale yellow in colour. The dorsal and ventral fin edges are dark. The lateral line is mostly straight, but curves slightly around the pectoral fin.[6]

Diet

The English sole's diet consists of zoobenthos organisms, primarily marine worms, molluscs, crustaceans and echinoderms. English sole feed by day, using both sight and smell, and often dig for food.[1][2][3]

Commercial Fishing

The English sole is an important commercial fish, and has been fished in the Eastern Pacific, almost exclusively by trawler, since 1876. Two fisheries exist: one on the West Coast of the United States, off Washington, Oregon and California, and one in the Bering Sea off Alaska. The majority of English sole landed is from the West Coast fishery.[2][3]

Although biomass is increasing, catches have been steadily decreasing since the 1960s - though catches peaked in the southern area in 1929 with 3,976 tonnes landed, and in the north in 1949 at 4,008 tonnes[2] - and have today almost reached a historical low. This decline is estimated to be due to a combination of market factors and management restrictions placed on trawlers in order to protect other bottom-dwelling species.[3]

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!