Overview

Comprehensive Description

Biology

Found in rocky areas, from the intertidal to 49 m (Ref. 2850). Sleeps on the oral disc, leaving the anemone (Urticina lofotensis) by day but returning every night (Ref. 45560). Commonly encountered hovering motionless by divers (Ref. 2850). Feeds on crustaceans, polychaetes, small mollusks and bryozoans (Ref. 4930). Neither anterolateral glandular grooves nor venom gland is present (Ref. 57406).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

British Columbia, Canadian Exclusive Economic Zone [Pacific part], Coastal Waters of Southeast Alaska and British Columbia, FAO fishing area 67, North East Pacific, North Pacific
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Pacific: Kodiak Island, Alaska to Point San Carlos, central Baja California, Mexico.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern North Pacific: northern Gulf of Alaska to northern Baja California.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 16; Dorsal soft rays (total): 14 - 16; Anal spines: 3 - 4; Analsoft rays: 12 - 13; Vertebrae: 36 - 39
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 250 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

25.0 cm TL (male/unsexed; (Ref. 4925)); max. reported age: 8 years (Ref. 56049)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Dorsal rayed part higher than spinous part. Caudal gently rounded. Anal notched between spinous and rayed parts, well incised (Ref. 6885). Head with scales; one fleshy cirrus above each eye and a pair on the occiput; gill membranes joined, free of isthmus. Body with 7 dark vertical bands. Pelvic fin of moderate length, not reaching the anus (Ref. 48751).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Holotype for Oxylebius pictus
Catalog Number: USNM 4470
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Locality: San Francisco, San Francisco County, California, United States, Pacific
  • Holotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; marine; depth range ? - 49 m (Ref. 2850)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 2 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 1.6775 - 9

Graphical representation

Depth range (m): 1.6775 - 9
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 49m.
Recorded at 49 meters.

Habitat: demersal. Found in rocky areas, intertidal to 49 m. Rarely caught on baited hook. Commonly encountered hovering motionless by divers.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Oxylebius pictus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 14 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTGGCACCCTTTATCTAGTATTTGGTGCTTGAGCTGGAATAGTAGGTACTGCCCTAAGCCTATTAATTCGGGCGGAACTAAGCCAACCCGGCGCCCTCCTGGGGGACGACCAAATTTATAACGTCATTGTTACGGCGCATGCCTTCGTAATAATTTTCTTTATAGTAATACCAATTATGATCGGAGGCTTCGGAAACTGACTTATCCCCTTAATGATTGGGGCCCCCGATATAGCCTTCCCTCGAATAAACAACATGAGCTTTTGACTCCTCCCACCATCTTTTCTCCTCCTCCTGGCTTCTTCAGGGGTTGAAGCTGGAGCCGGAACAGGTTGAACAGTCTACCCCCCTCTAGCCGGCAATTTAGCTCACGCTGGAGCATCTGTTGATTTAACAATTTTTTCCCTGCATTTAGCCGGGATTTCTTCGATTCTTGGTGCTATTAACTTCATCACAACCATCATTAACATGAAACCCCCTGCCATTTCTCAGTACCAAACACCCCTCTTTGTGTGGTCTGTCCTAATCACTGCCGTTCTCCTGCTTCTTTCTCTTCCCGTTCTTGCTGCTGGGATCACAATGCTCCTCACAGATCGAAATCTAAACACCACTTTCTTTGACCCTGCAGGGGGAGGAGACCCAATTCTCTACCAACACTTGTTCTGATTCTTCGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Oxylebius pictus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 14
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 7 specimens with morphological vouchers housed at Queensland Museum
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Painted greenling

The painted greenling, Oxylebius pictus, is a marine fish native to the eastern Pacific Ocean. Its range is from Kodiak Island, Alaska to central Baja California.[1] It can reach a total size of 25 cm and has seven vertical dark bands. It inhabits rocky areas usually shallower than 50 m. It feeds on crustaceans, polychaetes, small molluscs and bryozoans.

Taken in the Northern Channel Islands, California

References

  1. ^ Froese, Rainer, and Daniel Pauly, eds. (2006). "Oxylebius pictus" in FishBase. February 2006 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!