Overview

Comprehensive Description

Biology

Found inshore, on sandy substrates (Ref. 9840, 75154) to depths of 50m (Ref.58048). Inhabits shallow coastal waters (Ref. 45255). Ovoviviparous (Ref. 50449). Common catch of the demersal tangle net, bottom trawl and, occasionally, longline fisheries. Utilized for its meat, skin (very high value) and cartilage (Ref.58048). Max. Length of female given in Ref. 74367.
  • Last, P.R. and J.D. Stevens 1994 Sharks and rays of Australia. CSIRO, Australia. 513 p. (Ref. 6871)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Indian Ocean and western central Pacific: patchy occurrence from southeastern Africa, Mozambique, Madagascar, Socotra Islands, India, Indonesia, Thailand, Malaysia, Philippines, northern Australia and New Guinea (Last and Stevens 1994, Compagno and Heemstra 1984, Compagno et al. 2005, Stehmann 1995, Manjaji 2004).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: probably widely distributed but with patchy occurrence. Known from southern Africa and India to Australia and Papua New Guinea.
  • Last, P.R. and J.D. Stevens 1994 Sharks and rays of Australia. CSIRO, Australia. 513 p. (Ref. 6871)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Max. size

130 cm WD (male/unsexed; (Ref. 11228)); 110.8 cm WD (female)
  • Heemstra, P.C. 1995 Additions and corrections for the 1995 impression. p. v-xv. In M.M. Smith and P.C. Heemstra (eds.) Revised Edition of Smiths' Sea Fishes. Springer-Verlag, Berlin. (Ref. 11228)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 1040 mm WD
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Found inshore, on sandy substrates (Ref. 9840).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
An inshore ray, usually found at less than 50 m depth (Compagno and Heemstra 1984, Kuiter and Debelius 1994, Stehmann 1995, Manjaji 2004, White et al. 2006), but recently recorded from 100 m depth off northwest Australia (J. Pogonoski pers. comm. 2008). Seen in reef areas off Thailand (Vidthyanon pers. obs. 2007). Attains a maximum size of at least 104 cm DW (~200 cm total length) (White et al. 2006, Last and Compagno 1999). Males mature at about 70 cm disc width (DW) and size at birth is between 20 and 27 cm DW (White and Dharmadi 2007, Last and Stevens 1994). Reproduction is viviparous, with histotrophy and diet presumably consists of crustaceans and small fishes (White et al. 2006).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; brackish; marine; depth range 33 - 50 m (Ref. 9840)
  • Last, P.R. and L.J.V. Compagno 1999 Dasyatididae. Stingrays. p. 1479-1505. In K.E. Carpenter and V.H. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 3. Batoid fishes, chimaeras and bony fishes part 1 (Elopidae to Linophrynidae). FAO, Rome. (Ref. 9840)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 4 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 8 - 36.5
  Temperature range (°C): 26.525 - 26.692
  Nitrate (umol/L): 0.565 - 0.923
  Salinity (PPS): 35.037 - 35.095
  Oxygen (ml/l): 4.572 - 4.685
  Phosphate (umol/l): 0.120 - 0.122
  Silicate (umol/l): 0.869 - 1.019

Graphical representation

Depth range (m): 8 - 36.5

Temperature range (°C): 26.525 - 26.692

Nitrate (umol/L): 0.565 - 0.923

Salinity (PPS): 35.037 - 35.095

Oxygen (ml/l): 4.572 - 4.685

Phosphate (umol/l): 0.120 - 0.122

Silicate (umol/l): 0.869 - 1.019
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 50m.
Recorded at 50 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Found on the continental shelf (Ref. 75154).
  • Hoese, D.F., D.J. Bray, J.R. Paxton and G.R. Allen 2006 Fishes. In Beasley, O.L. and A. Wells (eds.) Zoological Catalogue of Australia. Volume 35.2 Australia: ABRS & CSIRO Publishing, 1472 p. (Ref. 75154)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Exhibit ovoviparity (aplacental viviparity), with embryos feeding initially on yolk, then receiving additional nourishment from the mother by indirect absorption of uterine fluid enriched with mucus, fat or protein through specialised structures (Ref. 50449). Distinct pairing with embrace (Ref. 205).
  • Breder, C.M. and D.E. Rosen 1966 Modes of reproduction in fishes. T.F.H. Publications, Neptune City, New Jersey. 941 p. (Ref. 205)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Himantura jenkinsii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATTTGGTCTTCGGTGCATGAGCAGGGATAGTGGGCACTGGACTTAGCCTGCTCATTCGAACAGAACTAAGCCAACCAGGCGCACTACTAGGTGATGATCAGATCTATAATGTGATTGTTACTGCCCATGCCTTCGTAATAATCTTCTTCATGGTAATACCTATTATAATCGGTGGCTTTGGTAATTGACTGGTTCCCCTAATAATTGGCGCCCCAGACATAGCCTTTCCTCGAATAAACAACATAAGTTTCTGACTTCTACCACCATCCTTTCTGTTACTTCTGGCCTCTGCCGGGGTAGAGGCTGGGGCCGGAACAGGCTGAACAGTCTATCCCCCATTAGCTGGCAATCTAGCACATGCTGGTGCTTCAGTAGACCTGGCAATCTTTTCACTGCATCTCGCCGGTGTTTCCTCCATCCTTGCCTCCATTAATTTTATTACTACAATTGTTAATATAAAACCACCAGCAATCTCACAGTATCAAACACCCCTTTTCGTCTGATCGATCCTCATTACAGCCGTACTCCTATTATTATCCCTTCCCGTCTTAGCAGCAGGTATCACAATACTTCTCACTGACCGTAACCTCAATACAACCTTCTTTGATCCTGCAGGAGGAGGAGACCCAATTCTTTATCAACACCTCTTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Himantura jenkinsii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
Manjaji, B.M., Fahmi & White, W.T.

Reviewer/s
Valenti, S.V. & Fowler, S.L. (Shark Red List Authority)

Contributor/s

Justification
This stingray is patchily distributed in inshore waters (to at least 50 m depth) in the Indian and Western Central Pacific Oceans, from South Africa to Southeast Asia and off northern Australia. This species is taken as a utilised bycatch of tangle/gillnet, trawlnet, and dropline fisheries throughout Southeast Asia and parts of the Indian Ocean. Inshore fishing pressure is intense throughout this species' range in these areas. It is caught in particularly high numbers in the target fishery for rhynchobatids operating in the Arafura Sea. Although no species-specific data are available, overall catches of stingrays are reported to be declining, with fishermen having to travel further and further to sustain catch levels. This species is highly sought after in Southeast Asia for the high value of its skin. Given continuing high levels of exploitation throughout its range in Southeast Asia and evidence for declines in catches of stingrays, this sub-population is assessed as Vulnerable. Little is known of the population off southeastern Africa, although the species is probably taken as bycatch of shrimp trawlers there. Fisheries in northern Australia are generally well managed and the introduction of Turtle Exclusion Devices (TEDs) and other exclusion devices will have greatly reduced bycatch of this species. The species is considered at minimal threat throughout its wide range off northern Australia, where it is assessed as Least Concern because there is no information to suggest that this sub-population has declined. Overall, the extent of global decline is not considered sufficient to meet the threat criteria and the species is assessed as Least Concern globally due to its wide range off northern Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Uncommon.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Captured in demersal tangle net, bottom trawl and, occasionally, longline fisheries (White et al. 2006). Inshore fishing pressure is high throughout much of this species known range in the Indian Ocean and Southeast Asia.

This species is taken in commercial gillnet fisheries off Indonesia, particularly in the fishery that targets rhynchobatid rays in the Arafura Sea, and retained (Last and Compagno 1999, W. White pers. obs. 2007). It is thought to be heavily impacted in this area, where more than 600 trawl vessels operate (W. White pers. obs. 2007). The Rhynchobatus species gillnet fishery catches large numbers of stingrays and Himantura jenkinsii is important in this fishery. Catches in inshore waters have declined and these vessels are having to travel longer and longer distances to sustain catches. The rhynchobatid fisheries are very intensive in this region, thus the level of exploitation is extremely high. There is also evidence that fisherman in these regions increasingly illegally fish in Australian waters (Chen 1996, W. White unpub. data). This species is highly sought after for its valuable skin (W. White pers. obs. 2007) which can fetch high prices due to the large thorns on the tail.

In Sabah (Malaysia) and Indonesia, these species are often caught and landed in the inshore fisheries (trawls and longlines) (M. Manjaji and Fahmi pers. obs. 2007). Also taken by the Danish seine fishing gear. In Southeast Asia, most specimens caught as bycatch by commercial fisheries (especially trawlers) are landed and sold as food fish.

In Australia, large specimens are caught as byatch in the Australian Northern Prawn Trawl Fishery, but the introduction of Turtle Exclusion Devices (TEDs) and other exclusion devices is thought to have greatly reduced bycatch of this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
No specific measures in place.

In Malaysia, the SSG together with various government departments in Sabah and Sarawak States have initiated elasmobranch biodiversity studies since 1996 (Fowler et al. 2002). While the monitoring surveys should continue to ascertain the status and possible threats to this species here, as well as in other portions of its range. Further research is also required on the population, habitat and ecology and life history parameters. The fishery is largely unregulated (licenses being issued, but catches/ landings are not properly monitored), and presently there is no specific conservation actions in place to help address this problem.

In Australia, the use of Turtle Excluder Devices (TEDs) and Bycatch Reduction Devices (BRDs) in the Northern Prawn Fishery (NPF) has been compulsory since 2000 (Day 2000). The Northern Prawn Fishery Bycatch Action Plan (1998) also recommends that bycatch reduction targets be established and that bycatch levels be monitored (Day 2000).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
  • Last, P.R. and L.J.V. Compagno 1999 Dasyatididae. Stingrays. p. 1479-1505. In K.E. Carpenter and V.H. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 3. Batoid fishes, chimaeras and bony fishes part 1 (Elopidae to Linophrynidae). FAO, Rome. (Ref. 9840)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Jenkins' whipray

The Jenkins' whipray (Himantura jenkinsii) is a species of stingray in the family Dasyatidae, with a wide distribution in the Indo-Pacific region from South Africa to the Malay Archipelago to northern Australia. This large species grows to 1.5 m (4.9 ft) across and has a broad, diamond-shaped pectoral fin disc and a whip-like tail without fin folds. It has a band of heart-shaped dermal denticles running from between the eyes to the tail on its upper surface, along with a characteristic row of large spear-like thorns along the midline. It is uniform yellowish brown above, becoming grayish on the tail past the stinging spine, and white below; there is apparently a spotted color variant that had previously been described as a different species, the dragon stingray (H. draco).

Preying mainly on small bony fishes and crustaceans, the Jenkins' whipray is commonly found in inshore, sandy or silty habitats shallower than 50 m (160 ft). It is aplacental viviparous, with the females nourishing their developing young with histotroph ("uterine milk"). This species is regularly caught by coastal fisheries across much of its range, particularly in the Arafura Sea; its skin is highly valued for the large thorns, while the meat and cartilage may also be marketed. The International Union for Conservation of Nature (IUCN) has listed the Jenkins' whipray under Least Concern, noting that it faces minimal conservation threats off northern Australia, which encompasses a large portion of its range. However, the IUCN has assessed this species as Vulnerable in Southeast Asia, where intense fishing pressure has likely lead to significant population declines.

Contents

Taxonomy [edit]

The illustration that accompanied Annandale's 1909 description.

The first known specimens of the Jenkins' whipray were two 1.0 m (3.3 ft) wide adult males collected near Ganjam, India by the steamer Golden Crown, and described by Scottish zoologist Nelson Annandale in a 1909 issue of Memoirs of the Indian Museum. He named the new species Trygon jenkinsii, in honor of Dr. J. Travis Jenkins, the Scientific Advisor on Fisheries to the Government of Bengal, who assisted the Golden Crown expedition.[2] Other common names for this ray include brown stingray, golden whip ray, pointed-nose stingray, rough-back stingray, and sharpnose stingray.[3]

The Jenkins' whipray is easily confused for the pink whipray (H. fai), and has likely been misrepresented as that species in various publications.[1] In 2004, Mabel Manjaji grouped it with H. fai, H. gerrardi, H. leoparda, H. toshi, H. uarnak, and H. undulata in the 'uarnak' species complex.[4] The dragon stingray (H. draco), described from South Africa in 1984, closely resembles the Jenkins' whipray but has dark spots along the posterior margin of the disc. Similarly spotted rays have since been documented from the Arafura Sea, Sulu Sea, Sumatra, and western Sri Lanka, leading taxonomists to tentatively re-classify H. draco as a color morph of H. jenkinsii.[1]

Description [edit]

The Jenkins' whipray is typically plain yellowish brown in color, with a white disc margin and a darker tail.

The pectoral fin disc of the Jenkins' whipray is diamond-shaped and rather thick in the center, measuring 1.1–1.2 times wider than long; the outer corners of the disc are broadly rounded. The anterior margins of the disc are nearly straight and converge at a very obtuse angle on the snout, which has a barely protruding tip. The eyes are medium-sized and closely followed by larger spiracles. A short, broad curtain of skin with a finely fringed posterior margin is present between the long, thin nostrils. The mouth is wide and gently arched, and contains four papillae (nipple-shaped structures) on the floor, the inner pair of which is shorter than the outer.[5][6]

The pelvic fins are small and narrow. The cylindrical, tapering tail lacks fin folds and measures slightly longer than the disc width. One to three serrated, stinging spines are located atop the tail, approximately one-quarter of the total tail length back from the base. The upper surface of the disc has a granular texture and bears a broad central band of closely spaced, flattened heart-shaped dermal denticles, beginning between the eyes, becoming widest at the "shoulders", and extending to entirely cover the tail. One or more rows of large, spear-like thorns also run along the dorsal midline from the center of the disc to the base of the sting. Barring the possible spotted variant, this species is a uniform yellowish brown above, with the disc margin and underside white, and the tail gray past the sting. It can grow up to 1.5 m (4.9 ft) across and 3.0 m (9.8 ft) long.[5]

Distribution and habitat [edit]

The Jenkins' whipray is rather common, with a wide but patchy distributed in the tropical waters of the Indo-Pacific. It occurs off southeastern Africa (including Madagascar), the Socotra Islands near Yemen, South and Southeast Asia (including the Philippines), New Guinea, and northern Australia from Ningaloo Reef to the Gulf of Carpentaria.[1][5] This bottom-dwelling species is generally found close to shore in water under 50 m (160 ft) deep, though it has been recorded as far down as 100 m (330 ft) off northwestern Australia.[1] It prefers sandy or silty bottoms, often in lagoons, and has been known to enter brackish water.[3][7]

Biology and ecology [edit]

Jenkins' whiprays off a beach in the Maldives; this ray sometimes forms groups.

The Jenkins' whipray may be encountered alone or in groups; there is some evidence of segregation by sex.[7][8] Small teleost fishes form a substantial portion of its diet, while crustaceans are also taken.[1][9] One individual has been observed accompanying a smalleye stingray (Dasyatis microps) off Tofo, Mozambique.[10] Known parasites of this species include the tapeworms Dollfusiella ocallaghani, Parachristianella baverstocki, P. indonesiensis, and Pterobothrium platycephalum.[11] As in other stingrays, the Jenkins' whipray is aplacental viviparous: the developing embryos are sustained at first by yolk, which is later supplanted by histotroph ("uterine milk") produced by the mother. The newborns measure 20–27 cm (7.9–11 in) across, and males reach sexual maturity at 75–85 cm (30–33 in) across.[1][5]

Human interactions [edit]

Because of its large thorns, the Jenkins' whipray is highly prized for its skin; the meat and cartilage may also be utilized.[1][3] It is frequently taken intentionally and incidentally across much of its range by intensive coastal fisheries, using tangle nets, bottom trawls, seine nets, and to a lesser extent longlines. Particularly large numbers are caught by an Indonesian commercial gillnet fishery targeting wedgefishes, that operates in the Arafura Sea and increasingly, illegally, in Australian waters. Although species-specific data is lacking, this fishery has caused a substantial decline in overall stingray populations. Off northern Australia, the Jenkins' whipray is relatively protected; it is thought to contribute minimally to the bycatch of the Northern Prawn Fishery (NPF) since the mandatory introduction of Turtle Excluder Devices (TERs). The International Union for Conservation of Nature (IUCN) has assessed this species as of Least Concern globally and off northern Australia, and as Vulnerable in Southeast Asia due to the intensity and inadequate regulation of regional fishing activities.[1]

References [edit]

  1. ^ a b c d e f g h i Manjaji, B.M., Fahmi & White, W.T. (2006). "Himantura jenkinsii". IUCN Red List of Threatened Species. Version 2010.2. International Union for Conservation of Nature. Retrieved August 26, 2010. 
  2. ^ Annandale, N. (May 1909). "Report on the fishes taken by the Bengal fisheries steamer "Golden Crown." Part I, Batoidei". Memoirs of the Indian Museum 2 (1): 1–60. 
  3. ^ a b c Froese, Rainer and Pauly, Daniel, eds. (2010). "Himantura jenkinsii" in FishBase. August 2010 version.
  4. ^ Manjaji, B.M. (2004). Taxonomy and phylogenetic systematics of the Indo-Pacific Whip-Tailed Stingray genus Himantura Müller & Henle 1837 (Chondrichthyes: Myliobatiformes: Dasyatidae). Unpublished PhD Thesis, University of Tasmania.
  5. ^ a b c d Last, P.R. and J.D. Stevens (2009). Sharks and Rays of Australia (second ed.). Harvard University Press. p. 445–446. ISBN 0-674-03411-2. 
  6. ^ Randall, J.E. and J.P. Hoover (1995). Coastal Fishes of Oman. University of Hawaii Press. p. 45. ISBN 0-8248-1808-3. 
  7. ^ a b Hennemann, R.F. (2001). Sharks & Rays: Elasmobranch Guide of the World. IKAN-Unterwasserarchiv. p. 248. 
  8. ^ White, W. (2007). "Species and size compositions and reproductive biology of rays (Chondrichthyes, Batoidea) caught in target and non-target fisheries in eastern Indonesia". Journal of Fish Biology 70 (6): 1809–1837. doi:10.1111/j.1095-8649.2007.01458.x. 
  9. ^ Fahmi (March 2007). Diversity, Biology and Utilization of Chondrichthyans in West Central Indonesian Fisheries. MPhil Thesis, Centre for Marine Studies, The University of Queensland.
  10. ^ Pierce, S.J., W.T. White and A.D. Marshall (2008). "New record of the smalleye stingray, Dasyatis microps (Myliobatiformes: Dasyatidae), from the western Indian Ocean". Zootaxa 1734: 65–68. 
  11. ^ Campbell, R.A. and I. Beveridge (May 2009). "Oncomegas Aetobatidis Sp. Nov. (Cestoda: Trypanorhyncha), A Re-Description of O. Australiensis Toth, Campbell & Schmidt, 1992 and New Records of Trypanorhynch Cestodes from Australian Elasmobranch Fishes". Transactions of the Royal Society of South Australia 133 (1): 18–29. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!