Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Comprehensive Description

Biology

A sequentially protogynous hermaphrodite. In the Galapagos, the colorful appearance may be due to selective pressures and their increased feeding and decreased reproductive activities may serve to avoid extraordinary predation (Ref. 9227). Adults forage on a wide range of invertebrates and algae (Ref. 28023). Oviparous, distinct pairing during breeding (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Common names: hogfish (English), wrasse (English), vieja (Espanol)
 
Bodianus eclancheri (Valenciennes, 1846)


Harlequin hogfish,     Harlequin wrasse, Galapagos hogfish



Body robust, compressed;  large males  with pronounced hump between eyes; snout pointed; a canine tooth at rear of top jaw, 2 pairs of strong canines at front of top and bottom jaws; dorsal fin XII, 10; anal fin III, 11-12; adult  males  with long filaments on tail fin lobes; pectoral rays 17; lateral line unbroken, smoothly arched; scales large, 31-33 with pores on lateral line.



Adult coloration extremely variable from uniformly dark grey or brownish to bright orange or white with highly irregular and variable pattern of black blotching; juveniles pale yellow to white with 3 black stripes on head and body, also margins of median fins black.



Size: grows to about 61 cm.

Habitat: rocky reefs.

Depth: 5-45 m.

Ecuador to central Chile, also Galapagos Islands; in the Galapagos it is usually seen on rocky reefs in the cooler waters of the western islands (Isabela and Fernandina).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Southeast Pacific: Ecuador to central Chile. Originating in the Peru-Chile Province, it is found in the cooler waters of the Galapagos Islands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is endemic to the Eastern Pacific, and is found from Ecuador to central Chile, including the Galapagos Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Pacific: Peru to Chile, west to Galápagos Archipelago.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 5 (S) - 45 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific


 
Global Endemism: All species, East Pacific endemic, TEP non-endemic

Regional Endemism: All species, Tropical Eastern Pacific (TEP) non-endemic, Temperate Eastern Pacific, primarily, Peruvian province, primarily, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo), South Temperate (Peruvian Province )

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Size

Length max (cm): 61.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 610 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

61.0 cm TL (male/unsexed; (Ref. 5592))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Body moderately deep and compressed; head large and pointed; teeth elongate and compressed, resembling incisors; dorsal fin contiguous, with 12 spines; posterior rays of dorsal and anal fins forming filamentous lobes; lower branch of first gill arch with 9 to 10 gill rakers; variable, depending on size and sex; body brown, black, red or orange, but less than 5 percent of the population is entirely black (Ref. 55763).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 5 - 46 m (Ref. 5227)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This reef-associated species is poorly known throughout much of its range. In the Galapagos it is usually seen on rocky reefs in the cooler waters of the western islands (Isabela and Fernandina), and is usually present below the thermocline.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 8 - 8
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 5 - 46m.
From 5 to 46 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Near Bottom, Bottom, Bottom + water column

Habitat: Reef (rock &/or coral), Reef only, Rocks, Reef associated (reef + edges-water column & soft bottom)

FishBase Habitat: Reef Associated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Feeding

Feeding Group: Carnivore

Diet: mobile benthic worms, mobile benthic crustacea (shrimps/crabs), mobile benthic gastropods/bivalves, octopus/squid/cuttlefish, sea-stars/cucumbers/urchins, bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Pelagic spawner (Ref. 32168). Oviparous, distinct pairing during breeding (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bodianus eclancheri

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATCTAGTATTTGGTGCCTGAGCCGGAATAGTCGGCACCGCGCTAAGTTTACTTATCCGGGCAGAACTAAGCCAACCCGGTGCTCTCCTCGGAGACGACCAGATTTACAATGTTATTGTTACGGCGCACGCGTTCGTAATAATCTTCTTTATAGTAATACCAATCATGATTGGGGGCTTTGGAAACTGACTCATCCCCCTAATGATCGGGGCCCCAGACATGGCATTCCCTCGAATAAATAATATAAGCTTCTGGCTTCTTCCTCCATCTTTCCTCCTCCTACTCGCCTCTTCGGGGGTAGAGGCAGGGGCCGGGACTGGATGAACCGTCTATCCTCCACTAGCTGGCAATCTGGCCCACGCGGGGGCCTCGGTCGACCTAACCATTTTCTCTCTTCACTTAGCCGGGGTTTCCTCAATTTTAGGTGCAATTAATTTTATTACAACTATCATTAATATAAAACCACCAGCCATCTCGCAGTACCAAACACCCCTCTTTGTCTGAGCCGTTCTTATTACGGCTGTGCTTCTTTTGCTCTCTCTTCCGGTCCTCGCTGCCGGAATTACAATGCTCTTAACAGACCGAAATCTAAATACTACCTTCTTCGACCCAGCGGGAGGGGGGGATCCGATTCTATATCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Bodianus eclancheri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Allen, G., Lea, B., Rivera, F., Zapata, F., Merlen, G., Edgar, G., Russell, B.

Reviewer/s
Robertson, R., Liu, M., Sadovy, Y., Craig, M.

Contributor/s

Justification
This species is widespread in the Eastern Pacific, and is common in at least part of its range. Collection for the aquarium trade and artesanal fishing is not thought to be a major threat to this species at this time. It is listed as Least Concern. However, more research is needed to determine the population status, and to identify any major threats to this species in the majority (contential shelf) portion of its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Although widely distibuted, little is known on population status of this species along the continental coast. It is considered common in the west and south of the Galapagos Islands, and uncommon elsewhere.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
The impact of potential threats to this species is poorly-known. There may be possible population declines due
to fishing pressure in Galapagos. This fish is collected for the aquarium trade (Beltrán-León and Herrera, 2000), and minor captures are made by Galapagos artisanal fishers. Also, given this species preference for temperate waters, future oceanographic environmental changes associated with ENSO and global warming events may have detrimental effects on the marine ecosystems and this species, especially in the northern portion of its range (Gynn and Ault 2000, Chen et al. 2004, Soto 2001).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no known conservation measures for this species. However, this species distribution falls partially into a number of Marine Protected Areas in the Eastern Pacific region (WDPA 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!