Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Comprehensive Description

Biology

Adults inhabit rocky or coral areas (Ref. 9311). Sometimes also found on sandy bottoms and where marine plants abound (Ref. 9311). Solitary or forms aggregations of only a few individuals. Feed on crabs, brittle stars, mollusks, and sea urchins (Ref. 9311). At night, they agglomerate in cracks and crevices of rocks and caves to sleep (Ref. 9311). Marketed fresh (Ref. 9311). Starts life as a female, later becoming a functional male. Males defend temporary reproductive territories called leks. Sex change may be due to local social conditions, but it may also have a genetic component, since the reversal occurs over a limited size range (Ref. 28023). Oviparous, distinct pairing during breeding (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Common names: hogfish (English), vieja (Espanol)
 
Bodianus diplotaenia (Gill, 1862)


Mexican hogfish



Body robust, compressed;  large males  with pronounced hump between eyes; snout pointed; a canine tooth at rear of top jaw, 2 pairs of strong canines at front of top and bottom jaws; dorsal fin XII, 10; anal fin III, 12; adult  males  with long filaments on tail fin lobes and prolonged rays posteriorly on dorsal and anal fins ; pectoral rays 17; lateral line unbroken, smoothly arched; scales large, 31 with pores on lateral line.



IP:  reddish grading to yellow on posterior part of body and caudal fin; a pair of blackish stripes (may be broken) on upper half of side and individual scale margins brown to reddish;  TP:  bluish green with brown head (except lower jaw white) and narrow yellowish bar on middle of side; juveniles similar to IP but with yellow base color.


Maximum size to 76 cm, common to 35 cm.

Commonly seen on rocky reefs.

Depth: 5-75 m.



Central Baja California to the Gulf of California to northern Chile, including all the offshore islands.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Eastern Pacific: Guadalupe Island and throughout the Gulf of California to Chile, including the Cocos, Malpelo, Revillagigedo and the Galapagos islands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is endemic to the Eastern Pacific, and is found from central Baja California and the Gulf of California to northern Chile, including all the offshore islands of Clarion, the Revillagigedos, Clipperton, Isla de Cocos and the Galapagos. It is also recorded from the northern tip of Chile between Arica and Iquique.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Pacific: Gulf of California (Mexico) south to Peru, including offshore islands, west to Galapagos Archipelago.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 5 (S) - 75 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific


 
Global Endemism: All species, East Pacific endemic, Tropical Eastern Pacific (TEP) endemic

Regional Endemism: All species, TEP endemic, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo), South Temperate (Peruvian Province )

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Size

Length max (cm): 76.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 760 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

76.0 cm TL (male/unsexed; (Ref. 5592)); max. published weight: 9,000 g (Ref. 5592)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Body moderately deep and compressed; head large and pointed; teeth caniniform, enlarged, and somewhat crooked, two anterior pairs in each jaw; dorsal fin with 12 spines; posterior rays of anal and dorsal fins forming filamentous lobes; lower branch of first gill arch with 12 to 13 gill rakers; very large individuals blue, with a narrow, yellow, vertical bar immediately behind the posterior edge of the pectoral fin, juveniles red or reddish brown; females with 2 longitudinal black stripes (Ref. 55763).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Syntype for Bodianus diplotaenia
Catalog Number: USNM 2988
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): J. Xantus
Locality: Cape St. Lucas, Baja California., Baja California Sur, Mexico, Pacific
  • Syntype: Gill, T. N. 1862. Proceedings of the Academy of Natural Sciences of Philadelphia. 14 (3-4): 141-142.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 5 - 76 m (Ref. 9311), usually 5 - 18 m (Ref. 9311)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This reef-associated species inhabits rocky or coral areas to depths of 75m. It is sometimes also found on sandy substrate and where marine plants abound (Gomon, 1995). At Gulf of Chiriqui, this fish could be found in all types of substrata, except sand and rubble (Dominici-Arosemena and Wolff, 2006). This species can also occasionally be found in estuaries and coastal lagoons along the tropical eastern Pacific coast (Cooke, 1992).

This species is solitary or may form aggregations of only a few individuals. It feeds on crabs, brittle stars, mollusks, and sea urchins (Gomon, 1995). At night, this species agglomerates in cracks and crevices of rocks and caves to sleep (Gomon, 1995). It starts life as a female, later becoming a functional male. Males defend temporary reproductive territories called leks. Sex change may be due to local social conditions, but it may also have a genetic component, since the reversal occurs over a limited size range (Grove and Lavenberg, 1997).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known from seamounts and knolls
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 40 specimens in 1 taxon.
Water temperature and chemistry ranges based on 12 samples.

Environmental ranges
  Depth range (m): 1 - 50000
  Temperature range (°C): 19.490 - 27.666
  Nitrate (umol/L): 0.162 - 8.632
  Salinity (PPS): 32.938 - 35.261
  Oxygen (ml/l): 4.242 - 4.879
  Phosphate (umol/l): 0.327 - 1.385
  Silicate (umol/l): 2.028 - 17.402

Graphical representation

Depth range (m): 1 - 50000

Temperature range (°C): 19.490 - 27.666

Nitrate (umol/L): 0.162 - 8.632

Salinity (PPS): 32.938 - 35.261

Oxygen (ml/l): 4.242 - 4.879

Phosphate (umol/l): 0.327 - 1.385

Silicate (umol/l): 2.028 - 17.402
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 5 - 76m.
From 5 to 76 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Near Bottom, Bottom, Bottom + water column

Habitat: Reef (rock &/or coral), Reef only, Rocks, Corals, Reef associated (reef + edges-water column & soft bottom)

FishBase Habitat: Reef Associated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Inhabits rocky or coral areas (Ref. 9311). Sometimes also found on sandy bottoms and where marine plants abound (Ref. 9311). Solitary or forms aggregations of only a few individuals. Feeds on crabs, brittle stars, mollusks, and sea urchins (Ref. 9311). At night, agglomerates in cracks and crevices of rocks and caves to sleep (Ref. 9311). Mobile invertebrate feeder (Ref. 57615).
  • Westneat, M.W. 2001 Labridae. Wrasses, hogfishes, razorfishes, corises, tuskfishes. p. 3381-3467. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9823)   http://www.fishbase.org/references/FBRefSummary.php?id=9823&speccode=4844 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeding

Feeding Group: Carnivore

Diet: mobile benthic worms, mobile benthic crustacea (shrimps/crabs), mobile benthic gastropods/bivalves, sea-stars/cucumbers/urchins, ectoparasites
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, distinct pairing during breeding (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bodianus diplotaenia

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTTTATCTAGTATTTGGTGCCTGAGCCGGAATAGTCCGCTCCGCCCTAAGTTTACTAATCCGGGCTGAACTAAGCCAACCTGGCGCTCTCCTAGGAGACGACCAGATCTACAATGTTATTGTTACAGCGCACGCATTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGTGGATTTGGAAACTGACTCATCCCTCTAATGATTGGAGCCCCCGATATGGCTTTCCCTCGAATAAATAACATAAGCTTCTGACTTCTCCCCCCATCATTCTTACTCCTACTCGCTTCTTCCGGAGTAGAAGCGGGGGCCGGGACTGGTTGAACCGTTTATCCTCCACTAGCGGGCAACTTAGCCCACGCAGGAGCTTCGGTTGACCTAACGATCTTCTCTCTTCACTTAGCAGGGGTTTCCTCAATTTTAGGAGCAATTAATTTCATTACAACTATCATTAACATGAAACCCCCAGCCATTTCTCAGTATCAAACCCCATTATTCGTATGAGCAGTCTTAATTACAGCAGTACTACTTCTTCTATCCCTCCCAGTTCTTGCTGCTGGTATTACAATACTTCTCACAGATCGAAACCTCAACACCACCTTCTTTGACCCCGCAGGAGGGGGAGACCCAATTCTATATCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Bodianus diplotaenia

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 25
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Allen, G., Rivera, F., Edgar, G., Zapata, F.

Reviewer/s
Robertson, R., Liu, M., Sadovy, Y., Craig, M.

Contributor/s

Justification
This species is widespread in the Eastern Pacific, and common throughout most of its range. There are no known major threats to this species, and no current indication of population decline. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is considered to be abundant throughout much of its range.

This fish was studied in Gulf of Papagayo, Costa Rica (Dominici-Arosemena et al. 2005) with an density of 0.03±0.03 ind./ m2. At Gulf Dulce, Costa Rica, a mean density of 0.005±0.015 ind./ m2 was recorded, with a relative abundance of 0.131% (Figueroa, 2001). Within a five-site-study survey, at Catalinas Islands, this fish was observed 51 times in all sites (Espinoza and Salas, 2005). In Isla Gorgona, Rubio (1986) showed that this species is frequent in rocky and coralline substrates and occassionally found on sandy substrates. In a survey at Gorgona Island coral reefs, Colombia (Zapata and Morales, 1997), a mean density of 0.158 ind./10 m2 and a frequency of observation of 41.2% was registered. This species was studied in different sites at Galapagos archipelago, with an overall mean abundance of 18.4 ind./500 m2 (Edgar et al. 2004).

According to Aburto-Oropeza and Balart (2001), B. diplotaenia is a dominant species at Los Islotes, Gulf of California, with an occurrence frequency higher than 80%. In Cabo Pulmo, Mexico, this fish was considered common, with a relative abundance between 1-5%, and a relative frequency higher than 75% (Villarreal-Cavazos et al. 2000). In Bahía de Navidad, Jalisco, still in México, this fish was captured 4 times within 12 (one each month) field trips throughout a year (Rojo-Vázquez et al. 2001)

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
There are no major threats known for this species. According to Dominici-Arosemena et al. (2005), this is a important aquarium fish in Gulf of Papagayo, Costa Rica, but such localized collecting of juveniles is unlkely to affect population.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no known conservation measures for this species. However, this species distribution falls partially into a number of Marine Protected Areas in the Eastern Pacific region (WDPA 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!