Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Diurnal depths from 750 m, migrating to 100 m at night. Feeds on amphipod and crustacean remains (Ref. 6716).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Worldwide in tropical to temperate seas; Atlantic Ocean: between 43.3°N and 40°S; reported from Iceland
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Worldwide in tropical to temperate seas. Atlantic Ocean: between 38°N and 40°S; reported from Iceland (Ref. 12462). Indian Ocean: between 20°N and 39°S. Pacific Ocean: between 45°N and 42°S. South China Sea and East China Sea (Ref.74511).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Circumglobal in tropical through cold temperate seas, including Hawaiian Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 13 - 16; Analspines: 0; Analsoft rays: 13 - 16
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 110 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

11.0 cm SL (male/unsexed; (Ref. 4501))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

No spine above eye (Ref. 13628).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

nektonic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diurnal depths from 750 m, migrating to 100 m at night.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

bathypelagic; marine; depth range 100 - 3500 m (Ref. 74511)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 37 specimens in 1 taxon.
Water temperature and chemistry ranges based on 31 samples.

Environmental ranges
  Depth range (m): 0 - 3458.5
  Temperature range (°C): 2.393 - 17.363
  Nitrate (umol/L): 1.724 - 36.023
  Salinity (PPS): 34.390 - 35.508
  Oxygen (ml/l): 3.691 - 6.418
  Phosphate (umol/l): 0.285 - 2.406
  Silicate (umol/l): 1.847 - 75.870

Graphical representation

Depth range (m): 0 - 3458.5

Temperature range (°C): 2.393 - 17.363

Nitrate (umol/L): 1.724 - 36.023

Salinity (PPS): 34.390 - 35.508

Oxygen (ml/l): 3.691 - 6.418

Phosphate (umol/l): 0.285 - 2.406

Silicate (umol/l): 1.847 - 75.870
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 100 - 1130m.
From 100 to 1130 meters.

Habitat: bathypelagic. Uncommon species (Ref. 4246). Probable vertical migrator, shallowest day capture was at 775 m. Feeds on amphipod and crustaceans remains(Ref. 6716).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Diurnal depths from 750 m, migrating to 100 m at night. Feeds on amphipod and crustacean remains.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

Feeds on amphipod and crustacean remains
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Rondeletia loricata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACACGCTGATTTTTCTCGACCAACCACAAAGACATTGGTACCCTCTATCTAGTATTTGGTGCCTGAGCCGGCATAGTCGGCACAGCCCTAAGTCTTCTCATCCGGGCGGAACTAAGCCAACCGGGGGCCCTCCTAGGAGAT---GATCAAATTTATAACGTCATTGTTACGGCACACGCCTTTGTAATAATTTTCTTTATAGTAATACCAATTATAATTGGAGGATTCGGAAACTGACTGGTTCCCCTGATGATCGGGGCCCCAGATATAGCATTTCCCCGAATAAATAATATGAGTTTCTGACTTCTTCCCCCATCCTTCCTACTACTCCTGGCCTCTTCTGGGGTAGAGGCAGGCGCTGGAACAGGGTGAACAGTTTATCCACCCCTTGCAGGAAACCTCGCACACGCAGGAGCCTCCGTAGACCTCACCATTTTCTCCCTTCATTTAGCAGGTATCTCCTCAATTCTGGGGGCCATTAACTTTATTACAACCATTATTAATATAAAACCCCCTGCAATTTCACAATACCAAACTCCCCTCTTTGTATGATCCGTTTTAGTTACAGCCGTTCTACTCCTCCTCTCCCTACCCGTTCTTGCAGCCGGTATTACCATACTACTAACCGACCGTAACCTAAACACCACCTTCTTTGACCCGTCAGGAGGAGGAGACCCCATCCTATACCAACACCTGTTTTGATTTTTTGGGCACCCAGAAGTATATATTTTAATTCTTCCAGGGTTTGGTATAATCTCTCACATTGTCGCCTACTACTCTGGTAAAAAAGAACCCTTCGGTTATATGGGTATGGTCTGGGCTATAATAGCCATTGGCCTACTCGGGTTCATTGTATGAGCCCATCACATGTTTACAGTCGGTATAGACGTTGATACCCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Rondeletia loricata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Rondeletia loricata

Rondeletia loricata is a species of redmouth whalefish found in the temperate and tropical oceans at depths of from 100 to 3,500 m (330 to 11,480 ft). This species grows to a length of 11.0 cm (4.3 in). It is known to be a vertical migrant, occurring at shallower depths at night.[1]

References[edit]

  1. ^ Froese, Rainer and Pauly, Daniel, eds. (2012). "Rondeletia loricata" in FishBase. August 2012 version.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!