Overview

Brief Summary

WhyReef - Lifestyle

Achilles tang fishes can be found with others of their kind swimming in small groups. When they find their mate, they usually stay together with them for life.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

  Common names: tang (English), cirujano (Espanol), navajón (Espanol)
 
Acanthurus achilles Shaw, 1803


Achilles tang


Body an elongate oval; head profile steep; eye high on the head; mouth small, protrusible, low on head; teeth on jaws fixed, with flattened, notched tips, 8-28 on each jaw; gill rakers 16-20; dorsal rays IX, 29-33; anal rays III, 26-29; pectoral rays 16; pelvic fin I, 5; a single depressible spine fits into a groove on the side of the base of the tail; tail fin concave; scales very small, rough; lateral line complete.

Bluish black with a large elliptical orange patch posteriorly on body; a white slash or short bar covering middle of opercular membrane; tail fin with broad orange bar and white rear margin.


Size: to 26 cm.

Habitat: shallow surge areas of rocky and coral reefs.


Depth: 0-10 m.


The tropical central Pacific; in the eastern Pacific it has been seen near Cape San Lucas (Baja California) and inside the western Gulf, and a pelagic juvenile was collected near Clipperton Island.
   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Occurs in clear seaward reefs, usually in groups (Ref. 9710). Benthopelagic (Ref. 58302). Feeds on filamentous and small fleshy algae (Ref. 9267). Monogamous (Ref. 52884). Spine in caudal peduncle may be venomous. Size of metamorphosis from postlarva stage to juvenile is 6 cm (Ref. 9267). This species sometimes hybridizes with A. nigricans (Ref. 9808).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

WhyReef - Fun Facts

The achilles tang is a beautiful reef fish, but can be dangerous. The back part of its body, near its orange spot, can sting other animals. That means that it can hurt other fish that try to eat it, as well as humans that try to catch it.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Acanthurus achilles is found from the oceanic islands of Oceania to the Hawaiian and Pitcairn islands. It is also found in Wake, Marcus Island and the Marianas. It is also found in the Eastern Tropical Pacific from Mexico and other offshore islands such as Clipperton (Randall 2001). This species is unknown in Australia (Australian Biological Resources Study accessed 28 July 2010).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, TEP non-endemic, Pacific only (East + Central &/or West), "Transpacific" (East + Central &/or West Pacific), All Pacific (West + Central + East)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Continent + Island (s), Continent, Island (s)

Residency: Vagrant

Climate Zone: Northern Subtropical (Cortez Province + Sinaloan Gap), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Pacific: oceanic islands of Oceania to the Hawaiian and Pitcairn islands. Also known from Wake, Marcus, and Mariana islands. Eastern Central Pacific: southern tip of Baja California, Mexico (Ref. 9267) and other offshore islands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pacific: Caroline Islands east to Hawaiian Islands, Marquesas Islands and Pitcairn Group, straying to Baja California (Mexico), south to Torres Strait (Queensland, Australia), New Caledonia and Tonga.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 0 (S) - 10 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 29 - 33; Analspines: 3; Analsoft rays: 26 - 29
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length max (cm): 26.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 240 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

24.0 cm TL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Dark brown, nearly black in color. Erectile spine (sharp and forward-pointing) on each side of caudal peduncle which folds down into a groove. Mouth small, snout noticeably extended. Light blue ring around chin and presence of spot of same color on gill cover at angle of gill opening. Dorsal fin with soft part having longer base than spinous part. Juveniles lack the large orange spot on caudal area.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Acanthurus achilles is found in shallow water, generally less than about 5m, along rocky shores or coral reefs exposed to wave action. It maintains a territory very aggressively (Randall 2001). Like A. lineatus, it grazes on on algal turfs mainly on thallate and filamentous red and green algae (Choat et al. 2002, 2004). No demographic information is available for this species (J.H. Choat pers. comm. 2010).

The sexes are separate among the acanthurids (Reeson 1983). Acanthurids do not display obvious sexual dimorphism, males assume courtship colours (J.H. Choat pers. comm. 2010).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; marine; depth range 0 - 10 m (Ref. 27115), usually 0 - 4 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 13 specimens in 1 taxon.
Water temperature and chemistry ranges based on 9 samples.

Environmental ranges
  Depth range (m): 0.4575 - 9.15
  Temperature range (°C): 22.496 - 28.941
  Nitrate (umol/L): 0.137 - 2.714
  Salinity (PPS): 34.134 - 36.148
  Oxygen (ml/l): 4.517 - 5.079
  Phosphate (umol/l): 0.092 - 0.507
  Silicate (umol/l): 1.097 - 2.545

Graphical representation

Depth range (m): 0.4575 - 9.15

Temperature range (°C): 22.496 - 28.941

Nitrate (umol/L): 0.137 - 2.714

Salinity (PPS): 34.134 - 36.148

Oxygen (ml/l): 4.517 - 5.079

Phosphate (umol/l): 0.092 - 0.507

Silicate (umol/l): 1.097 - 2.545
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 10m.
Recorded at 10 meters.

Habitat: reef-associated. Occurs in clear seaward reefs, in the surge zone to a depth of 4 m. Usually in groups (Ref. 9710). Feeds on filamentous and small fleshy algae. Spine in caudal peduncle may be venomous. Size of metamorphosis from postlarva stage to juvenile is 6 cm (Ref. 9267). This species sometimes hybridizes with @A. nigricans@ (Ref. 9808).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Bottom, Bottom only

Habitat: Reef (rock &/or coral), Reef only, Rocks, Corals, Reef associated (reef + edges-water column & soft bottom)

FishBase Habitat: Reef Associated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Feeding

Feeding Group: Herbivore

Diet: benthic microalgae
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

WhyReef - Menu

The only thing they eat is turf algae—a carpet of many different kinds of plants found all over the reef. As they only eat plants, they are herbivores.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Hole-in-the-Head Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Columnaris Disease (e.). Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Acanthurus achilles

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Acanthurus achilles

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTTTATTTAGTATTTGGTGCTTGAGCTGGAATAGTAGGAACGGCCCTGAGCCTCCTAATTCGAGCAGAATTAAGCCAACCAGGCGCCCTCCTCGGGGACGACCAAATTTATAATGTAATTGTTACAGCACACGCATTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGTGGATTTGGAAATTGATTAATTCCACTAATGATTGGAGCTCCCGACATAGCATTCCCACGAATAAATAATATGAGCTTCTGGCTCCTGCCCCCATCCTTCCTGCTTCTACTAGCATCTTCTGCAGTAGAGTCTGGTGCTGGCACAGGATGAACAGTATACCCCCCTCTAGCCGGTAATTTAGCACATGCAGGAGCATCTGTAGACCTAACCATTTTCTCCCTCCACCTCGCAGGTATTTCTTCAATTCTTGGAGCTATCAATTTTATTACAACAATTATTAATATGAAACCTCCTGCTATTTCTCAATATCAAACCCCTCTATTTGTATGAGCCGTACTAATTACTGCTGTCCTACTTCTTCTTTCTCTTCCCGTTCTCGCCGCCGGTATCACAATGCTACTAACAGACCGTAATCTTAATACCACCTTCTTTGACCCGGCAGGGGGAGGAGACCCCATCCTGTACCAACATTTAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
Choat, J.H., Russell, B., Stockwell, B., Rocha, L.A., Myers, R., Clements, K.D., McIlwain, J., Abesamis, R. & Nanola, C.

Reviewer/s
Davidson, L., Edgar, G. & Kulbicki, M.

Contributor/s

Justification
Acanthurus achilles is widespread and abundant throughout its range. It is found in isolated oceanic islands and is caught only incidentally for food in parts of its distribution. It is a major component of the aquarium trade and is a popular food fish in West Hawaii. There is evidence of declines from collection and concern for the sustained abundance of this species. These localized declines are not considered to be affecting the global population. In Hawaii, where the demand for this species is high, conservation measures such as harvest management (bag limits) are being developed. Furthermore, harvest levels and and trade are closely monitored in Hawaii and this species occurs in a number of Fish Replenishment Areas in West Hawaii and a number of marine protected areas in parts of its range. It is therefore listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Acanthurus achilles is rare in the Marianas Islands. It is more common in the islands of Polynesia than Micronesia (Randall 2001). It is collected in several islands in the Pacific and based on visual surveys is abundant throughout its range (L. Rocha pers. comm. 2010).

In Kona, Hawaii, there was a 57% difference in abundance between control and collection sites (Tissot and Hallacher 2003). In Moorea Is., French Polynesia, it is a targeted marine ornamental fish, a total of 3,056 individuals were recorded here from 1990-1993 (Lecchini et al. 2006).
This species is one of the top 10 taxa collected for the aquarium trade in Hawaii with 337,781 individuals caught from FY 1976-2003. Catch has been in decline since FY 1990 (Walsh et al. 2004). Overall aquarium catch in fiscal years 2004 through 2006 reported 12,399 individuals caught/year and a value of $969,663/year (Friedlander 2006). In West Hawaii, 42,283 individuals were caught from FY 2005-2009 with a total value of $274,111 (Walsh et al. 2010).

There was a change in abundance recorded from nine monitoring stations in Fish Replenishment Areas (FRAs) in West Hawaii. FRAs were closed to aquarium collecting in 2000. Prior to establishment of FRAs density was recorded at 0.24 individuals/100 m2 and after establishment density was 0.15 individuals/100 m2 (Friedlander et al. 2006). There was a significant decrease in overall density across the nine Fish Replenishment Areas. However, the FRAs were shown to be effective in terms of increases inside the FRAs relative to long term marine protected areas. There was a highly variable pattern in all management areas from 1999-2005 with an overall decline from 2006-2009. Average densities of this species are very low on all transects: 0.26/100 m2. The deeper areas where the West Hawaii Aquarium Project transects are located is not the prime habitat for adults of this species. Acanthurus achilles inhabits high energy shallow surge zones. Initial results from shallow water surveys and other longer term studies suggest concern for the sustained abundance of this species. This species is a very popular food fish as well as an aquarium fish with both juveniles and adults harvested. Low levels of recruitement over the past 11 years = 0.09/100 m2 appear insufficient to compensate current level of harvest (Walsh et al. 2010).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Acanthurus achilles is targeted heavily in Hawaii and there may be evidence of declines in some parts. In Kona, Hawaii, there were fewer individuals observed at collection than at control sites (Tissot and Hallacher 2003).

Surgeonfishes show varying degrees of habitat preference and utilization of coral reef habitats, with some species spending the majority of their life stages on coral reef while others primarily utilize seagrass beds, mangroves, algal beds, and /or rocky reefs. The majority of surgeonfishes are exclusively found on coral reef habitat, and of these, approximately 80% are experiencing a greater than 30% loss of coral reef area and degradation of coral reef habitat quality across their distributions. However, more research is needed to understand the long-term effects of coral reef habitat loss and degradation on these species' populations. Widespread coral reef loss and declining habitat conditions are particularly worrying for species that recruit into areas with live coral cover, especially as studies have shown that protection of pristine habitats facilitate the persistence of adult populations in species that have spatially separated adult and juvenile habitats (Comeros-Raynal et al. 2012).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

WhyReef - Threats

Since many people enjoy them as food or pets, too many achilles tang fishes get taken out of the reef. Reefs are in danger, and that means so is the home of the achilles tang fish!
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
In Hawaii, nine Fish Replenishment Areas were established in 2000. These areas prohibit marine aquarium organism collecting within approximately 30% of the Kona coast nearshore habitat (Kusumaatmadja et al. 2004). In 2002, the Marine Aquarium Council initiated a three-year project designed to enhance coral reef conservation in the islands by facilitating MAC certification of qualifying aquarium industry operators and encouraging market incentives (MAC 2003).

The Hawaii Division of Aquatic Resources is currently in the process of developing comprehensive package of size and bag limits. There is a recommended bag limit of 10 Achilles Tang per person per day which would apply to all harvesters including commercial fishers and aquarium collectors (Walsh et al. 2010).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Acanthurus achilles

Acanthurus achilles is a tropical marine fish with the common names Achilles tang and Achilles surgeonfish.

Appearance[edit]

They are a medium surgeonfish reaching a maximum of 25 cm (10 in) at adulthood. Acanthurus achilles are black with striking orange and white lining along the fish's fins and tail. When the fish matures, a prominent orange drop shape develops on the caudal area, terminating into a sharp spine.

Diet[edit]

The Achilles tang is herbivorous, eating mostly benthic algae. They will also accept frozen and meaty foods such as brine shrimp and mysis shrimp in captivity. As with all surgeonfish, algae or similar vegetable matter should be included in their dietary intake to moderate aggression and regulate metabolic functions.

Range[edit]

It is found in various reefs of Oceania, up to the islands of Hawaii and Pitcairn. The fish is also, although less commonly, found in the Mariana Islands and even some reefs in southern Mexico and Guatemala.

In the aquarium[edit]

The Achilles tang has a poor survival rate when kept in captivity. They are not for the inexperienced aquarist. However, a more experienced saltwater aquarist might think about keeping an Achilles. They are peaceful aquarium inhabitants and will rarely bother their tank-mates. Just about the only exception is when kept with other tangs or surgeonfish, particularly of their own species. Then they will become aggressive towards the other Tang. They are reef-safe, and can be kept with any invertebrates. Possible tankmates include clownfish, blennies, gobies, Chromis, butterflyfish, and small lionfish.

Turbulent water flow and surface movement (either in the display aquarium or attached sump) is essential for Achilles health. Heavy surface movement brings water oxygen levels near saturation. Keeping an adult Achilles well fed can be a chore, with one adult easily consuming one 5"×5" sheet of pressed seaweed daily. Selcon-type products can be utilized several times a week to supplement their diet. A lowered reef temperature of 78°F can also assist in keeping an Achilles fat. A standard reef temperature of 80–82°F will raise the Achilles' metabolism to a point where adequate nutrition will be difficult. Introducing a specimen of about 5 inches is ideal; juveniles do not fare well (if they can even be found).

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!