Overview

Comprehensive Description

Biology

Inhabits bays and shallow coastal waters.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Atlantic: Florida, USA and Bahamas to Curaçao and Colombia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal soft rays (total): 69 - 75; Analsoft rays: 56 - 61
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 51 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

5.1 cm TL (male/unsexed; (Ref. 7251))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Body pale with six to ten large dark blotches which are variously positioned in different individuals but frequently at the periphery of the body; upper and lower blotches are generally in vertical alignment, the last pair often confluent; scattered small dark spots on head and body (Ref. 13442).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Paratype for Symphurus arawak
Catalog Number: USNM 198200
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): J. Randall
Year Collected: 1952
Locality: Curacao: Lagoen, Curacao, ABC Islands, Netherlands Antilles, Lesser Antilles, Caribbean Sea, Atlantic
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 3 - 39 m (Ref. 26268), usually 6 - 30 m
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 2 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 10.9 - 24.4
  Temperature range (°C): 27.421 - 27.421
  Nitrate (umol/L): 0.424 - 0.424
  Salinity (PPS): 35.410 - 35.410
  Oxygen (ml/l): 4.687 - 4.687
  Phosphate (umol/l): 0.081 - 0.081
  Silicate (umol/l): 2.021 - 2.021

Graphical representation

Depth range (m): 10.9 - 24.4
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 3 - 39m.
From 3 to 39 meters.

Habitat: demersal. Inhabits bays and shallow coastal waters.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Symphurus arawak

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TGTACTTAATTTTTGGTGCCTGAGCCGGGATAATTGGCACAGCCCTAAGCGTCATCATTCGAGTGGAACTAAGCCAGCCCGGACCGATAATAGGCGACGACCAAATCTACAATGTAGTAGTGACAGCACACGCTTTCGTTATAATTTTTTTTATAGTTATGCCTGTGCTTATTGGAGGCTTTGGTAACTGGCTTGTCCCCCTAATGCTAGGAGCCCCCGACATAGCTTTCCCGCGAATAAACAACATAAGTTTCTGGCTTCTCCCCCCTTCCTTCCTTCTTCTCCTGTCCTCATCAGCAGTTGAAGCCGGGGCCGGCACAGGGTGAACAGTCTACCCCCCGCTATCTAGTAACCTCGCCCATGCCGGAGCTTCAGTGGACCTAGCAATTTTTTCTCTTCACCTGGCGGGAGTCTCATCTATTCTCGGGGCAATTAATTTTATTACTACAATCTTCAACATAAAGCCAGCTACTATAACTATTTACCAAATGCCTTTATTTATCTGATCAGTCTTAATCACGGCTGTCCTTTTACTTTTATCCCTCCCTGTTCTAGCTGCAGCAATTACAATACTTTTAACCGACCGAAATTTAAACACAGCCTTTTTTGACCCTGCCGGCGGAGGCGACCCAATCCTTTACCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Symphurus arawak

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!