Overview

Comprehensive Description

Biology

Inhabits rocky runs and pools of small to medium rivers.
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

endemic to a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (5000-20,000 square km (about 2000-8000 square miles)) Monongahela and Greenbrier river systems (Ohio River basin), southern Pennsylvania, Maryland, and West Virginia; possibly in Lake Erie drainage, New York and Ohio; rare (Page and Burr 1991). Only historical evidence exists for occurrence in Lake Erie drainage, Pennsylvania; confirmed recent records from Monongahela River watershed (Maryland, Pennsylvania, West Virginia) and one other Ohio River tributary (West Virginia).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

U.S.A.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America: Monongahela and Greenbrier River systems (Ohio River basin) in southern Pennsylvania, Maryland and West Virginia, USA; possibly in Lake Erie drainage in New York and Ohio, USA.
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 120 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

12.0 cm TL (male/unsexed; (Ref. 5723))
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Holotype for Rhinichthys bowersi
Catalog Number: USNM 61576
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): W. Hay
Year Collected: 1899
Locality: Dry Fork of Cheat R., Harmon, W. Va., West Virginia, United States, North America
  • Holotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Rhinichthys bowersi
Catalog Number: USNM 126495
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): W. Hay
Year Collected: 1899
Locality: W.Va: Cheat Bridge Cheat River, West Virginia, United States, North America
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Comments: Runs and pools of small to medium, unacidified mountain rivers with moderate current and gravel or cobble substrate.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 6 - 20

Comments: Reported from about a dozen streams, but not found in several of these during surveys in 1980s.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

Unknown

Comments: Always found in extremely small numbers; known from most streams from one to ten individuals; extensive collecting in range has yielded about 70 specimens since 1890.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pararhinichthys bowersi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTTTATCTTGTATTTGGTGCCTGAGCCGGGATAGTGGGAACCGCTTTAAGCCTCCTTATTCGAGCCGAGCTTAGCCAACCCGGGTCACTCTTGGGTGATGACCAAATTTATAACGTCATCGTTACCGCCCACGCTTTTGTTATAATTTTCTTTATAGTCATGCCAATTCTTATTGGCGGCTTCGGAAACTGGCTTGTACCCCTAATAATCGGTGCACCAGACATAGCATTCCCACGAATAAATAACATAAGCTTCTGACTTCTACCCCCATCATTTCTACTGTTGCTAGCTTCTTCTGGTGTTGAGGCTGGCGCTGGAACAGGGTGAACTGTATACCCCCCGCTCGCAGGCAACCTCGCCCACGCAGGAGCATCAGTAGACCTCACAATCTTCTCTCTACACCTAGCAGGTGTATCATCAATTTTAGGGGCAGTTAACTTTATTACCACAATTATTAATATGAAACCCCCAGCCATCTCCCAATATCAAACGCCTCTCTTTGTGTGGGCCGTACTTGTGACCGCTGTACTCCTACTCCTATCACTACCCGTCCTAGCTGCCGGAATTACAATACTTCTCACTGACCGTAATCTTAATACTACATTCTTCGACCCGGCAGGGGGAGGAGACCCAATCTTATACCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pararhinichthys bowersi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N1 - Critically Imperiled

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G1 - Critically Imperiled

Reasons: Known from about a dozen streams in Pennsylvania, West Virginia, and Maryland, but populations are very small and not confirmed in several streams recently; habitat is at risk from acid-mine runoff; status as a valid species is doubtful--apparently an F1 hybrid.

Intrinsic Vulnerability: Moderately vulnerable

Environmental Specificity: Narrow. Specialist or community with key requirements common.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Unknown

Global Long Term Trend: Decline of 50-70%

Comments: Area of occupancy, number of subpopulations, and abundance have declined substantially, although the level of decline is not precisely known.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: Very high - high

Comments: Species occurs in an area of severe stream acidification due to acid mine runoff; may be threatened by acid rain, flood-control dams.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Biological Research Needs: Determine viability and trends of populations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: None. No occurrences appropriately protected and managed

Comments: No sites adequately protected, although several streams partially in the Monongahela National Forest and one partially in a Maryland state scenic river.

Needs: Maintain water quality, especially via permitting process for coal mining.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Cheat minnow

Pararhinichthys bowersi, the cheat minnow, is a demersal, freshwater fish endemic to the United States, most commonly found in the Ohio River basin. It is the only species in the genus Pararhinichthys.

Endangered species[edit]

In the United States the Cheat minnow is considered to be Endangered, under the Endangered Species Act.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: A hybrid between Rhinichthys cataractae and Nocomis micropogon; morphologically intermediate between these two species. Not a polyploid (Morgan et al. 1984). Goodfellow et al. (1984) believed that electrophoretic data indicate that R. bowersi is a valid species and not an F1 hybrid. Stauffer et al. (1997) redescribed R. bowersi as a valid species of hybrid origin and placed it in a new genus "Pararhinichthys." However, Poly and Sabaj (1998) considered "the evidence used to support the species status of R. bowersi to be inconclusive and, with respect to the electrophoretic data, critically flawed." Poly and Sabaj (1998) concluded that R. bowersi is best considered as an F1 hybrid. Page and Burr (2011) did not recognize this taxon as a valid species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!