Overview

Distribution

endemic to a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Upper Kentucky and upper Green (including Barren River) river systems, eastern and central Kentucky and north-central Tennessee; primarily in upland streams of the Cumberland Plateau and central portions of the Highland Rim; fairly common in Kentucky River drainage (where occurs from Red River upstream and including the South Fork), uncommon and localized in Green River drainage; in the Green River occurs, primarily upstream of the confluence of the Little Barren and Green rivers; in the Barren River, most common upstream of the confluence of Drakes Creek and the Barren River; in Tennessee, restricted to large tributaries of the Barren River system in Clay, Macon, and Sumner counties; there is an old record from the Nolin River system, where the species no longer occurs; reports of this species (as P. cymatotaenia) from Obion Creek in western Kentucky, creeks near Paducah (Kentucky), and the Big Sandy and Licking River drainages (Kentucky) are based on misidentified specimens of Percina sciera (Burr and Page 1993, Page and Burr 1991). See Burr and Page (1993) for spot map and list of localities.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Upper Kentucky and upper Green (including Barren River) river systems, eastern and central Kentucky and north-central Tennessee; primarily in upland streams of the Cumberland Plateau and central portions of the Highland Rim; fairly common in Kentucky River drainage (where occurs from Red River upstream and including the South Fork), uncommon and localized in Green River drainage; in the Green River occurs, primarily upstream of the confluence of the Little Barren and Green rivers; in the Barren River, most common upstream of the confluence of Drakes Creek and the Barren River; in Tennessee, restricted to large tributaries of the Barren River system in Clay, Macon, and Sumner counties; there is an old record from the Nolin River system, where the species no longer occurs; reports of this species (as P. cymatotaenia) from Obion Creek in western Kentucky, creeks near Paducah (Kentucky), and the Big Sandy and Licking River drainages (Kentucky) are based on misidentified specimens of Percina sciera (Burr and Page 1993, Page and Burr 1991). See Burr and Page (1993) for spot map and list of localities.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America: USA.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Kentucky and Tennessee, U.S.A.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Type Information

Paratopotype for Percina stictogaster Burr & Page
Catalog Number: USNM 231070
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): R. Bouchard & W. Starnes
Year Collected: 1969
Locality: Jacks Ck At Ky 66. Clay Co., Ky. Kentucky R Dr., Clay County, Kentucky, United States, North America
  • Paratopotype: Burr, B. B. & Page, L. M. 1993. Bulletin of the Alabama Museum of Natural History. 16: 19, 1.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Comments: Quiet water areas, especially flowing pools, backwater pools, and vegetated riffle margins of clear creeks and small to medium rivers (usually stream orders 3-5). More often swims in midwater than near bottom. May rest on submerged mats of tree roots along bank. In winter, may be found in accumulations of dead leaves.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Quiet water areas, especially flowing pools, backwater pools, and vegetated riffle margins of clear creeks and small to medium rivers (usually stream orders 3-5). More often swims in midwater than near bottom. May rest on submerged mats of tree roots along bank. In winter, may be found in accumulations of dead leaves.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

benthopelagic; freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Spawning evidently peaks from mid-March through mid-April; probably lives a maximum of about 3 years (Burr and Page 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Percina stictogaster

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATCTAGTATTTGGTGCTTGAGCCGGAATAGTAGGCACCGCTCTAAGCTTACTTATCCGAGCAGAGCTAAGCCAGCCCGGCGCACTCCTGGGAGACGACCAAATTTATAACGTCATTGTTACAGCGCACGCCTTTGTAATAATTTTCTTTATAGTGATGCCCATTATGATCGGGGGCTTTGGAAACTGACTCGTGCCTCTGATGATCGGTGCCCCCGACATGGCATTTCCTCGAATAAACAACATGAGTTTCTGACTTCTACCCCCCTCCTTCCTCCTACTCCTTGCCTCCTCCGGAGTAGAAGCTGGAGCTGGGACCGGGTGAACCGTCTACCCACCCCTGGCTGGAAACTTAGCACACGCCGGGGCATCCGTTGATTTAACCATCTTCTCCCTGCATCTGGCAGGGATTTCTTCAATTTTAGGGGCCATTAATTTTATTACAACTATTATTAACATAAAACCCCCCGCCATTTCTCAGTACCAAACCCCCTTATTCGTTTGAGCTGTCCTGATTACTGCTGTGCTCCTTCTTCTTTCTCTCCCCGTGCTTGCCGCAGGCATCACAATACTGCTTACAGACCGCAACTTAAACACCACTTTCTTTGACCCTGCAGGAGGGGGTGACCCCATTCTTTACCAACACTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Percina stictogaster

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
NatureServe

Reviewer/s
Smith, K. & Darwall, W.R.T.

Contributor/s

Justification
Listed as Least Concern in view of the large extent of occurrence, large number of subpopulations, large population size, and lack of major threats. Trend over the past 10 years or three generations is uncertain but likely relatively stable, or the species may be declining but not fast enough to qualify for any of the threatened categories under Criterion A (reduction in population size).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is represented by a large number of subpopulations and locations.

Total adult population size is unknown but relatively large.

In the Green River, apparently less abundant now than in the 1960s (Burr and Page 1993).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Comments: Vulnerable to decimation through perturbations such as strip mining; stream channelization projects threaten available habitat in Tennessee (Burr and Page 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
Vulnerable to decimation through perturbations such as strip mining; stream channelization projects threaten available habitat in Tennessee (Burr and Page 1993).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Currently, this species is of relatively low conservation concern and does not require significant additional protection or major management, monitoring, or research action.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Percina stictogaster

The frecklebelly darter (Percina stictogaster) primarily occurs in the upper Kentucky and Green river systems of eastern and central Kentucky and north-central Tennessee, being found mostly in the Cumberland Plateau and Highland Rim regions.[1] The fish gets its name from gets its name from the scattered dark spots on its relatively pale underside. However, a possible more telling characteristic of the species is the systematical arrangement of the spots at the base of the tail as well as the continuous stripes down either side of the back. Total population size is unknown but figured to be relatively large. The frecklebelly darter is a benthic darter that relies on invertebrates as its principal diet. The frecklebelly darter can be found primarily in creeks and small rivers with a moderate gradient and a pool/riffle type flow, and spends most of its time in midwater areas of the stream.[2] The major threats of the frecklebelly darter include decimation through perturbations such as strip mining as well as stream channelization projects. The darter is thought to have a high resilience with minimum population doubling time less than 15 months; it is also believed to have low vulnerability. Frecklebelly darter females contain about 100-300 mature ova depending on size. Fish become mature by age 1. Spawning in this darter species involves egg burial where the male mounts the female and deposits eggs in deep depressions created by receptive females.

Geographic distribution[edit]

The frecklebelly darter has a rather small distribution. Found in only two states, Tennessee and Kentucky, the species is endemic to higher elevation streams and reservoirs. found primarily in the Upper Kentucky and upper Green (including Barren River) river systems in eastern and central Kentucky and north-central Tennessee. The darter propagates upland streams of the Cumberland Plateau and central portions of the Highland Rim. Fairly common in Kentucky River drainage (where occurs from Red River upstream and including the South Fork), the darter is uncommon and localized in the Green River drainage. In the Green River, the frecklebelly darter occurs primarily upstream of the confluence of the Little Barren and Green rivers. In the Barren River, it is most common upstream of the confluence of Drakes Creek and the Barren River. The frecklebelly darter is restricted to large tributaries in Tennessee, primarily of the Barren River system in Clay, Macon, and Sumner counties. There is an old record from the Nolin River system, where the species no longer occurs.[2] The frecklebelly darter as well as most other darter species in the area are vulnerable to decimation through perturbations such as strip mining; stream channelization projects threaten available habitat in Tennessee. It is believed that these factors as well as the damming of natural river systems may have extirpated the species from other areas in the southeast. Non-native Invasive fish species could also be a cause of limited distribution.

Ecology[edit]

The frecklebelly darter is a benthic fish which inhabits quiet water areas, especially flowing pools, backwater pools, and vegetated riffle margins of clear creeks and small to medium rivers (usually stream orders 3-5). The darter most often swims in midwater than near bottom. Oftentimes it can be found resting on submerged mats of tree roots along bank. In winter the fish may be found in accumulations of dead leaves. Spawning of the species evidently peaks from mid-March through mid- April.[3] The fish is estimated to live about 3 years. The frecklebelly darter does not show any time of migration. The darter feeds on invertebrates which include river snails, hydropsychid caddisfly larvae, midge larvae, and small mayfly nymphs such as baetids. This fish is likely a prey item for almost any piscivorous fish that occur within the darter’s range, such as Largemouth Bass, Smallmouth Bass, and other large piscivores. Fish with similar habitat requirements are the greatest competitors to the fish. It seems that this particular species desires cooler water temperatures that come with higher elevations. Many of the regions where the fish exist are suspect to mining operations as well as river damming. Either of the these projects could very well be detrimental to the fish species.[4]

Life history[edit]

The frecklebelly darter has a poorly studied life history. Spawning of the species evidently peaks from mid-March through mid-April. The fish is estimated to live about three years. Based on length frequency data this species is reproductively mature at age one. Spawning occurs in temperatures of 7 to 16 °C (45 to 61 °F) in areas with strong current and fine gravel. Aquarium observations confirm that this species buries its eggs in a manner similar to other Percina darters. Fertilized eggs are about 2.5 mm in diameter, clear, demersal and slightly adhesive. At 10 °C (50 °F) eggs hatched in 18–25 days.[5] Females of the species are thought to reach sexual maturity at age one and when spawning, lay their eggs in the substrate of the lake or river bed. Males of the species have a semicircular keel on the caudal peduncle that appears to function as a ploughshare which, in conjunction with the long anal fin, delivers sepermatozoa to buried in the substrate. Compared to sympatric darters, early spawning results in relatively large young, which may reduce predation in this relatively pelagic species.[6]

Current management[edit]

Like many non-game species, little is known about the frecklebelly darter.[5][7] The darter is state listed as being in need of management categorized as critically imperiled.[8]

References[edit]

  1. ^ Warren Jr, Melvin L., et al. "Diversity, distribution, and conservation status of the native freshwater fishes of the southern United States." Fisheries 25.10 (2000): 7-31.
  2. ^ a b Strange, Rex Meade, and Brooks M. Burr. "Intraspecific phylogeography of North American highland fishes: a test of the Pleistocene vicariance hypothesis." Evolution (1997):885-897.
  3. ^ Page, Lawrence M. "The subgenera of Percina (Percidae: Etheostomatini)." Copeia (1974): 66-86.
  4. ^ Reproductive Biology and Early Life History of Fishes in the Ohio River Drainage: Percidae - Perch, Pikeperch, and Darters, Volume 4 (Google EBook). Google Books. N.p., n.d. Web. 25 Nov. 2013.
  5. ^ a b Kentucky Darters. Kentucky Darters. N.p., n.d. Web. 25 Nov. 2013http://johno.myiglou.com/fish/darters.html
  6. ^ "Percina Stictogaster Burr & Page, 1993." FishBase. N.p., n.d. Web. 25 Nov. 2013.http://fishbase.sinica.edu.tw/Summary/SpeciesSummary.php?ID=56238
  7. ^ Percina Stictogaster. (Frecklebelly Darter). N.p., n.d. Web. 25 Nov. 2013 http://www.iucnredlist.org/details/202597/0
  8. ^ Page, Lawrence M., and Mark H. Sabaj. "The function of the caudal keel in Percina (Percidae)." Environmental biology of fishes 40.1 (1994): 105-107.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Has been included in P. cymatotaenia by some authors (Kuehne and Barbour 1983). Most closely related to P. cymatotaenia (Burr and Page 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!