Overview
Distribution
North America: Mexico.
-
Jelks, H.L., S.J. Walsh, N.M. Burkhead, S. Contreras-Balderas, E. DÃaz-Pardo, D.A. Hendrickson, J. Lyons, N.E. Mandrak, F. McCormick, J.S. Nelson, S.P. Platania, B.A. Porter, C.B. Renaud, J.J. Schmitter-Soto, E.B. Taylor and M.L. Warren Jr. 2008 Conservation status of imperiled North American freshwater and diadromous fishes. Fisheries 33(8):372-407. (Ref. 81264)
http://www.fishbase.org/references/FBRefSummary.php?id=81264&speccode=11953
© FishBase
Source:
FishBase
Trusted
Physical Description
Type Information
Syntype for Cyprinella rubripinna Garman
Catalog Number: USNM 120257
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Photograph
Collector(s): Palmer
Year Collected: 1880
Locality: Parras, Mexico, Mexico, North America
Catalog Number: USNM 120257
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Photograph
Collector(s): Palmer
Year Collected: 1880
Locality: Parras, Mexico, Mexico, North America
- Syntype: Garman. 1881. Bulletin of the Museum of Comparative Zoology. 8 (3): 91.
© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Trusted
Ecology
Habitat
Molecular Biology and Genetics
Molecular Biology
Barcode data: Cyprinella garmani
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 5 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 5 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
CCTTTATTTAGTATTTGGTGCCTGAGCCGGAATAGTGGGAACCGCTTTAAGCCTCCTTATTCGCGCTGAATTAAGTCAACCTGGCTCGCTTCTAGGTGATGACCAGATCTATAATGTTATTGTCACGGCTCACGCCTTCGTAATAATTTTCTTTATAGTAATACCAATTCTTATCGGTGGGTTTGGAAACTGACTCGTACCTCTAATAATTGGGGCACCTGATATAGCATTCCCACGAATAAATAACATAAGCTTCTGACTTTTACCCCCATCGTTCCTGTTATTATTAGCTTCCTCTGGTGTAGAAGCCGGGGCTGGAACGGGATGAACTGTGTATCCTCCCCTCGCCGGTAATTTAGCCCACGCAGGCGCATCAGTAGATCTCACAATTTTCTCCCTGCACCTGGCGGGAGTATCCTCAATTCTAGGGGCAGTTAATTTTATTACTACAATTATTAATATGAAGCCCCCAGCAATCTCTCAATATCAAACTCCTCTCTTCGTTTGGGCCGTACTTGTAACTGCTGTCCTTCTACTCCTCTCATTGCCTGTCCTAGCTGCCGGGATTACTATACTTCTCACTGACCGTAACCTAAACACTACGTTCTTTGACCCAGCAGGGGGAGGCGACCCTATTCTGTACCAACACTTA
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Cyprinella garmani
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Conservation
Threats
Not Evaluated
-
IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
http://www.fishbase.org/references/FBRefSummary.php?id=57073
© FishBase
Source:
FishBase
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
