Overview

Distribution

North America: Mexico.
  • Jelks, H.L., S.J. Walsh, N.M. Burkhead, S. Contreras-Balderas, E. Díaz-Pardo, D.A. Hendrickson, J. Lyons, N.E. Mandrak, F. McCormick, J.S. Nelson, S.P. Platania, B.A. Porter, C.B. Renaud, J.J. Schmitter-Soto, E.B. Taylor and M.L. Warren Jr. 2008 Conservation status of imperiled North American freshwater and diadromous fishes. Fisheries 33(8):372-407. (Ref. 81264)   http://www.fishbase.org/references/FBRefSummary.php?id=81264&speccode=11953 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mexico.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Type Information

Syntype for Cyprinella rubripinna Garman
Catalog Number: USNM 120257
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Photograph
Collector(s): Palmer
Year Collected: 1880
Locality: Parras, Mexico, Mexico, North America
  • Syntype: Garman. 1881. Bulletin of the Museum of Comparative Zoology. 8 (3): 91.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

benthopelagic; freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cyprinella garmani

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATTTAGTATTTGGTGCCTGAGCCGGAATAGTGGGAACCGCTTTAAGCCTCCTTATTCGCGCTGAATTAAGTCAACCTGGCTCGCTTCTAGGTGATGACCAGATCTATAATGTTATTGTCACGGCTCACGCCTTCGTAATAATTTTCTTTATAGTAATACCAATTCTTATCGGTGGGTTTGGAAACTGACTCGTACCTCTAATAATTGGGGCACCTGATATAGCATTCCCACGAATAAATAACATAAGCTTCTGACTTTTACCCCCATCGTTCCTGTTATTATTAGCTTCCTCTGGTGTAGAAGCCGGGGCTGGAACGGGATGAACTGTGTATCCTCCCCTCGCCGGTAATTTAGCCCACGCAGGCGCATCAGTAGATCTCACAATTTTCTCCCTGCACCTGGCGGGAGTATCCTCAATTCTAGGGGCAGTTAATTTTATTACTACAATTATTAATATGAAGCCCCCAGCAATCTCTCAATATCAAACTCCTCTCTTCGTTTGGGCCGTACTTGTAACTGCTGTCCTTCTACTCCTCTCATTGCCTGTCCTAGCTGCCGGGATTACTATACTTCTCACTGACCGTAACCTAAACACTACGTTCTTTGACCCAGCAGGGGGAGGCGACCCTATTCTGTACCAACACTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Cyprinella garmani

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!