Overview

Comprehensive Description

Biology

Inhabits lagoon and sheltered seaward reefs in coral rich areas (Ref. 1602, 58652). Possibly to 120 m depths. Young is more inshore on sheltered reef crests or slopes, usually amongst soft corals or stinging hydrozoans (Ref. 48635). Feeds on hard-shelled mollusks, crustaceans, and sea urchins (Ref. 27550). The species is observed to swim with a group of goatfish and change its color to resemble these fish, it then darts out from the group to catch small fish (Ref. 2334). Minimum depth reported from Ref. 9823.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Red Sea, Indo-West Pacific: East Africa, Natal (South Africa), Seychelles, Madagascar and Mascarenes east to Wake Atoll and Gambier Islands, north to Ryukyu Islands, south to New Caledonia and Tonga.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-Pacific: Red Sea and East Africa to the Marshall Islands and Samoa.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is found from the Red Sea and East Africa to the Marshall Islands and Samoa, north to Taiwan and south to the Great Barrier Reef.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, Natal (South Africa), Seychelles, Madagascar and Mascarenes east to Wake Atoll and Gambier Islands, north to Ryukyu Islands, south to New Caledonia and Tonga.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 10; Analspines: 3; Analsoft rays: 8 - 11
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 400 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Maximum size: 400 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

40.0 cm SL (male/unsexed; (Ref. 9823))
  • Westneat, M.W. 2001 Labridae. Wrasses, hogfishes, razorfishes, corises, tuskfishes. p. 3381-3467. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9823)   http://www.fishbase.org/references/FBRefSummary.php?id=9823&speccode=4844 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Differs from the very similar C. unifasciatus by always lacking the white bar in front of the caudal base as well as the area clear of red streaks extending from the eye to just above the pectoral axis (Ref. 1602).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth: 3 - 50m.
From 3 to 50 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; brackish; marine; depth range 3 - 50 m (Ref. 30573)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species inhabits coral-rich areas of lagoon and sheltered seaward reefs, from three to possibly 120 m (Lieske and Myers 1994). It is solitary. Although it has been observed to swim with a group of goatfish, change its colour to resemble these fish, and dart out from the group to capture small fish (Randall et al. 1997).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 106 specimens in 1 taxon.
Water temperature and chemistry ranges based on 63 samples.

Environmental ranges
  Depth range (m): 0.55 - 57
  Temperature range (°C): 24.633 - 29.205
  Nitrate (umol/L): 0.019 - 2.007
  Salinity (PPS): 32.019 - 35.547
  Oxygen (ml/l): 4.130 - 4.851
  Phosphate (umol/l): 0.055 - 0.415
  Silicate (umol/l): 0.810 - 7.448

Graphical representation

Depth range (m): 0.55 - 57

Temperature range (°C): 24.633 - 29.205

Nitrate (umol/L): 0.019 - 2.007

Salinity (PPS): 32.019 - 35.547

Oxygen (ml/l): 4.130 - 4.851

Phosphate (umol/l): 0.055 - 0.415

Silicate (umol/l): 0.810 - 7.448
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 3 - 30m.
From 3 to 30 meters.

Habitat: reef-associated. Cheilinus diagrammus = Cheeklined wrasse.  (Lacepede, 1801)  Colour reddish-brown to olivaceous, sometimes with broad white stripes on body; seven to nine diagonal maroon lines on cheek nearly at right angles to diagonal orange-red lines passing anteriorly and posteriorly from eye. Head and most of caudal fin of adults green; ability to assume a broad striped pattern. Attains 30 cm. Feeds in part on fishes. Inhabits singly coral rich laggons and sheltered seaward reefs. East Africa, to Micronesia and Samoa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs inshore (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Transversotrema Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Oxycheilinus digramma

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 13 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTCTACCTTGTTTTTGGTGCCTGAGCTGGGATAGTGGGCACAGCCCTAAGCTTGCTTATTCGAGCAGAACTCAGTCAACCAGGAGCTCTTCTTGGAGACGACCAGATTTATAATGTAATCGTTACCGCCCATGCCTTCGTTATGATTTTCTTTATAGTAATGCCAATCATAATTGGAGGCTTTGGGAACTGACTTATTCCGTTAATGGTGGGAGCCCCCGATATGGCCTTCCCTCGGATAAACAATATGAGTTTCTGACTTCTACCCCCATCTTTCCTTCTCCTACTTGCCTCTTCTGGGGTAGAAGCAGGTGCCGGTACTGGATGAACAGTTTACCCCCCACTAGCGGGGAACTTAGCCCACGCCGGTGCGTCCGTAGACCTTACAATTTTCTCCCTGCACTTAGCAGGGATTTCCTCAATTCTGGGGGCCATCAATTTCATTACTACTATTATTAATATGAAGCCCCCCGCCATCACTCAGTACCAGACACCTCTGTTCGTATGGGCAGTCCTAATTACTGCAGTCCTCCTTCTCCTTTCTCTCCCTGTTTTGGCCGCTGGGATTACAATGCTCTTAACAGACCGCAACCTAAATACTACTTTCTTCGACCCGGCCGGTGGTGGGGACCCAATCCTCTACCAACATCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Oxycheilinus digramma

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at Museum of Tropical Queensland
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Liu, M. & To, A.

Reviewer/s
Craig, M.T. & Carpenter, K.E.

Contributor/s

Justification
This species has a wide distribution. It prefers coral-rich areas, and is common in many parts of its range. There are no major threats known. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is considered to be common in many parts of its range.

Population information for this species has occasionally been recorded. For instance, from a beam trawl survey in Tanzania, the density was reported to be 0.01 individual per 1,000 m2 in seagrass bed, which is less preferred habitat for this species (Gullström 2008), from a UVC using five 20 x 1 m belt transects, six individuals with size range 6-30 cm total length were sighted (Shibuno et al. 2008), and from a dive survey in the Solomon Islands, this species was reported to be a moderately common species (Allen 2006).

In Fiji, Tonga and New Caledonia, this species was commonly recorded, 187, 242 and 769 individuals were counted in various UVC surveys (M. Kulbicki pers. comm.). However, this species is not common in French-Polynesia, only five individuals were counted (M. Kulbicki pers. comm.).

On the east coast of Peninsular Malaysia, a mean density of 0.7 individuals from twenty 50 m X 5 m transects was recorded in underwater fish visual surveys (Yusuf et al. 2002).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
There are no major threats to this species. This species is not considered as a food fish in Taiwan (Shao 2005), however, it may be utilized in subsistence fisheries. This species was reported to be collected for the aquarium trade in Mozambique (Whittington et al. 2000).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are many marine protected areas throughout the distribution of this species. For example, it is known that this species occurs within the Kenting National Park of Taiwan (Shao 2005). However, specific management on this species is largely lacking throughout its range of occurrence.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: very high; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Oxycheilinus digramma

Oxycheilinus digramma (Cheeklined wrasse) is a fairly large fish species of the family Labridae.

Contents

Size and appearance

The fish grows to a length of about 40 centimeters. The side of the fish's head has horizontal stripes while the front of the head has red spots. Coloring of the fish varies from pale gray to purple. Aquarium specimens are less tense than their wild counterpart.[1]

Habitat

Oxycheilinus digramma live in coral reefs, sheltered inland areas, and lagoons possibly at a depth of 120 meters.[2]

Diet

This species of fish eat sea urchins, molluscs, and crustaceans. A hunting technique of this species it to use other fish as a moving blind to approach its prey.[1]

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!