Overview

Distribution

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North Pacific: northern Kuril Islands and Kamchatka, Russia to the Anadyr Gulf and Sitka, Alaska.
  • Allen, M.J. and G.B. Smith 1988 Atlas and zoogeography of common fishes in the Bering Sea and northeastern Pacific. NOAA Tech. Rep. NMFS 66, 151 p. (Ref. 6793)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North Pacific: southern Chukchi Sea to southeastern Alaska and to Okhotsk Sea off Hokkaido, Japan.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 11 - 12; Dorsal soft rays (total): 18 - 23; Analspines: 0; Analsoft rays: 16 - 18
  • Masuda, H., K. Amaoka, C. Araga, T. Uyeno and T. Yoshino 1984 The fishes of the Japanese Archipelago. Vol. 1. Tokai University Press, Tokyo, Japan. 437 p. (text). (Ref. 559)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 410 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

41.0 cm TL (male/unsexed; (Ref. 2850))
  • Eschmeyer, W.N., E.S. Herald and H. Hammann 1983 A field guide to Pacific coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 336 p. (Ref. 2850)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Paralectotype; Syntype for Hemilepidotus jordani Bean
Catalog Number: USNM 201606
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): S. Bailey
Year Collected: 1880
Locality: Iliuliuk Unalaska, Alaska, United States, Pacific
  • Paralectotype: ; Bean, T. H. 1881. Proceedings of the United States National Museum. 4 (210): 153.; Syntype: ; Bean, T. H. 1881. Proceedings of the United States National Museum. 4 (210): 153.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lectotype; Syntype for Hemilepidotus jordani Bean
Catalog Number: USNM 27598
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): S. Bailey
Year Collected: 1880
Locality: Iliuliuk Unalaska, Alaska, United States, Pacific
  • Lectotype: ; Bean, T. H. 1881. Proceedings of the United States National Museum. 4 (210): 153.; Syntype: ; Bean, T. H. 1881. Proceedings of the United States National Museum. 4 (210): 153.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; marine; depth range 0 - 604 m (Ref. 50550)
  • Fedorov, V.V., I.A. Chereshnev, M.V. Nazarkin, A.V. Shestakov and V.V. Volobuev 2003 Catalog of marine and freswater fishes of the northern part of the Sea of Okhotsk. Vladivostok: Dalnauka, 2003. 204 p. (Ref. 50550)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 50 specimens in 1 taxon.
Water temperature and chemistry ranges based on 31 samples.

Environmental ranges
  Depth range (m): 0 - 420
  Temperature range (°C): -0.959 - 7.258
  Nitrate (umol/L): 5.917 - 39.761
  Salinity (PPS): 31.897 - 33.804
  Oxygen (ml/l): 1.983 - 7.807
  Phosphate (umol/l): 0.954 - 2.965
  Silicate (umol/l): 11.561 - 97.859

Graphical representation

Depth range (m): 0 - 420

Temperature range (°C): -0.959 - 7.258

Nitrate (umol/L): 5.917 - 39.761

Salinity (PPS): 31.897 - 33.804

Oxygen (ml/l): 1.983 - 7.807

Phosphate (umol/l): 0.954 - 2.965

Silicate (umol/l): 11.561 - 97.859
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 25 - 525m.
From 25 to 525 meters.

Habitat: demersal. Occurs in subtidal areas and up to 110 m depth.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hemilepidotus jordani

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

GGCACAGCCCTAAGCCTCCTAATTCGAGCAGAGCTGAGCCAACCCGGAGCCCTTTTAGGGGACGACCAAATTTATAATGTAATTGTTACGGCCCATGCTTTCGTAATAATTTTCTTTATAGTAATACCAATCATGATCGGAGGCTTTGGAAACTGACTCATCCCTCTGATGATCGGCGCCCCCGACATAGCATTTCCCCGAATAAATAACATGAGCTTCTGGCTCCTCCCTCCCTCCTTTCTACTGCTTCTCGCCTCATCAGGGGTAGAAGCAGGGGCCGGAACAGGGTGAACAGTTTATCCCCCTCTCGCTGGCAATCTAGCTCACGCGGGAGCCTCTGTTGACCTAACAATTTTCTCCCTCCATTTGGCAGGGATCTCCTCAATTCTTGGGGCAATTAATTTTATCACAACCATCATCAACATGAAACCTCCTGCCATCTCTCAGTACCAGACGCCTCTTTTCGTCTGATCCGTTCTTATCACGGCCGTTTTACTCCTTCTCTCCCTGCCAGTCCTTGCTGCCGGCATCACGATGCTTCTAACAGACCGCAATCTTAACACCACCTTCTTCGACCCAGCGGGTGGTGGAGACCCCAT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Hemilepidotus jordani

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
  • Eschmeyer, W.N., E.S. Herald and H. Hammann 1983 A field guide to Pacific coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 336 p. (Ref. 2850)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!