Overview

Distribution

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North Pacific: northern Kuril Islands and Kamchatka, Russia to the Anadyr Gulf and Sitka, Alaska.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North Pacific: southern Chukchi Sea to southeastern Alaska and to Okhotsk Sea off Hokkaido, Japan.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 11 - 12; Dorsal soft rays (total): 18 - 23; Analspines: 0; Analsoft rays: 16 - 18
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 410 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

41.0 cm TL (male/unsexed; (Ref. 2850))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Paralectotype; Syntype for Hemilepidotus jordani Bean
Catalog Number: USNM 201606
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): S. Bailey
Year Collected: 1880
Locality: Iliuliuk Unalaska, Alaska, United States, Pacific
  • Paralectotype: ; Bean, T. H. 1881. Proceedings of the United States National Museum. 4 (210): 153.; Syntype: ; Bean, T. H. 1881. Proceedings of the United States National Museum. 4 (210): 153.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lectotype; Syntype for Hemilepidotus jordani Bean
Catalog Number: USNM 27598
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): S. Bailey
Year Collected: 1880
Locality: Iliuliuk Unalaska, Alaska, United States, Pacific
  • Lectotype: ; Bean, T. H. 1881. Proceedings of the United States National Museum. 4 (210): 153.; Syntype: ; Bean, T. H. 1881. Proceedings of the United States National Museum. 4 (210): 153.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; marine; depth range 0 - 604 m (Ref. 50550)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 50 specimens in 1 taxon.
Water temperature and chemistry ranges based on 31 samples.

Environmental ranges
  Depth range (m): 0 - 420
  Temperature range (°C): -0.959 - 7.258
  Nitrate (umol/L): 5.917 - 39.761
  Salinity (PPS): 31.897 - 33.804
  Oxygen (ml/l): 1.983 - 7.807
  Phosphate (umol/l): 0.954 - 2.965
  Silicate (umol/l): 11.561 - 97.859

Graphical representation

Depth range (m): 0 - 420

Temperature range (°C): -0.959 - 7.258

Nitrate (umol/L): 5.917 - 39.761

Salinity (PPS): 31.897 - 33.804

Oxygen (ml/l): 1.983 - 7.807

Phosphate (umol/l): 0.954 - 2.965

Silicate (umol/l): 11.561 - 97.859
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 25 - 525m.
From 25 to 525 meters.

Habitat: demersal. Occurs in subtidal areas and up to 110 m depth.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Hemilepidotus jordani

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Hemilepidotus jordani

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

GGCACAGCCCTAAGCCTCCTAATTCGAGCAGAGCTGAGCCAACCCGGAGCCCTTTTAGGGGACGACCAAATTTATAATGTAATTGTTACGGCCCATGCTTTCGTAATAATTTTCTTTATAGTAATACCAATCATGATCGGAGGCTTTGGAAACTGACTCATCCCTCTGATGATCGGCGCCCCCGACATAGCATTTCCCCGAATAAATAACATGAGCTTCTGGCTCCTCCCTCCCTCCTTTCTACTGCTTCTCGCCTCATCAGGGGTAGAAGCAGGGGCCGGAACAGGGTGAACAGTTTATCCCCCTCTCGCTGGCAATCTAGCTCACGCGGGAGCCTCTGTTGACCTAACAATTTTCTCCCTCCATTTGGCAGGGATCTCCTCAATTCTTGGGGCAATTAATTTTATCACAACCATCATCAACATGAAACCTCCTGCCATCTCTCAGTACCAGACGCCTCTTTTCGTCTGATCCGTTCTTATCACGGCCGTTTTACTCCTTCTCTCCCTGCCAGTCCTTGCTGCCGGCATCACGATGCTTCTAACAGACCGCAATCTTAACACCACCTTCTTCGACCCAGCGGGTGGTGGAGACCCCAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!