Overview

Comprehensive Description

Biology

Inhabits rubble and gravel-bottomed pools and riffles of headwaters, creeks and small rivers. Where the Cottus rhotheus and C. aleuticus do not occur, this species occupies riffles ; at localities where all occur together, it shifts to pools.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

endemic to a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (20,000-200,000 square km (about 8000-80,000 square miles)) Range includes Pacific Slope drainages from the Snohomish River and Puget Sound, Washington, south to the Rogue River system, Oregon and California (Page and Burr 1991), including the Willamette and Upper Deschutes river drainages and, in California, the Middle Fork of the Applegate River and tributary creeks of the Rogue River drainage (e.g., Elliot Creek) (Moyle et al. 1989). Some populations are isolated by dams from other populations downstream.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Range includes Pacific Slope drainages from the Snohomish River and Puget Sound, Washington, south to the Rogue River system, Oregon and California (Page and Burr 1991), including the Willamette and Upper Deschutes river drainages and, in California, the Middle Fork of the Applegate River and tributary creeks of the Rogue River drainage (e.g., Elliot Creek) (Moyle et al. 1989). Some populations are isolated by dams from other populations downstream.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America: Pacific Slope drainages from Snohomish River and Puget Sound in Washington to Rogue River system in Oregon and California, USA.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Northwestern U.S.A.: Oregon, Washington, California.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 11 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 100 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

10.0 cm TL (male/unsexed; (Ref. 5723))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Cottus perplexus
Catalog Number: USNM 45387
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): C. Gilbert & Jenkins
Year Collected: 1893
Locality: Skookunchuck R. Near Chehalis, Wash., Washington, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cotype for Cottus perplexus
Catalog Number: USNM 45388
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): C. Gilbert & Jenkins
Year Collected: 1893
Locality: Newaukum R., Near Chehalis, Wash., Washington, United States, North America
  • Cotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Comments: This sculpin occurs in a variety of habitats, but mainly occurs in the slower sections of coastal headwaters, creeks, and small rivers (Moyle 1976). It prefers faster water with rubble or gravel substrate, but occurs in pools and along stream edges when other sculpin species are present. Often it occurs in clear cold water in forested areas. Ideal habitat: cold creeks in old growth forest, with plenty of riffles and runs and flow of 10+ cfs. This species is tolerant of variable water temperatures up to 30 C and salinities up to 18 ppt. Where other sculpin species are common, spawning occurs in slow-flowing areas; where other sculpin species are rare or absent; spawning usually occurs in riffles (Moyle 1976). Eggs are laid on undersides of rocks 10-45 cm in diameter. Fry are benthic in quiet water after leaving the nest.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This sculpin occurs in a variety of habitats, but mainly occurs in the slower sections of coastal headwaters, creeks, and small rivers (Moyle 1976). It prefers faster water with rubble or gravel substrate, but occurs in pools and along stream edges when other sculpin species are present. Often it occurs in clear cold water in forested areas. Ideal habitat: cold creeks in old growth forest, with plenty of riffles and runs and flow of 10+ cfs. This species is tolerant of variable water temperatures up to 30 C and salinities up to 18 ppt. Where other sculpin species are common, spawning occurs in slow-flowing areas; where other sculpin species are rare or absent; spawning usually occurs in riffles (Moyle 1976). Eggs are laid on undersides of rocks 10-45 cm in diameter. Fry are benthic in quiet water after leaving the nest.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Feeds primarily on aquatic insect larvae (e.g., larvae of: mayfles, stonefies, chironomids, beetles, caddisflies, etc.). Rarely eats fishes (Moyle 1976).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: This species is represented by a large number of occurrences (subpopulations).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Comments: Total adult population size is unknown but apparently quite large (likely greater than 100,000).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Slow growing; reaches maturity at 2 years of age. Spawns in spring when water temperature exceeds 6-7 C. Fecundity ranges from 35 to 315 eggs per female, depending on size (Moyle 1976). Male guards nest with eggs contributed by multiple females.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cottus perplexus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATATCTAGTATTTGGTGCTTGAGCCGGAATAGTAGGCACAGCCTTAAGCCTCCTAATTCGAGCAGAATTAAGCCAACCCGGCGCCCTTTTGGGGGACGACCAGATTTATAATGTAATTGTTACGGCCCATGCTTTCGTAATAATTTTCTTTATAGTAATACCAATTATAATTGGGGGTTTCGGGAACTGACTCATTCCCCTAATGATCGGCGCCCCTGATATGGCCTTTCCTCGAATGAACAATATGAGCTTTTGACTTCTTCCCCCATCTTTTTTACTCCTCCTAGCCTCTTCGGGGGTCGAAGCAGGAGCCGGAACCGGATGAACAGTTTACCCGCCCCTCGCCGGGAACCTCGCCCACGCAGGGGCTTCTGTTGACCTAACAATCTTCTCCCTTCACCTAGCAGGTATCTCTTCTATTCTTGGAGCAATCAACTTTATCACAACTATCATTAATATGAAACCCCCTGCTATTTCTCAATACCAGACCCCTCTATTCGTATGATCTGTTCTTATTACTGCTGTCCTACTGCTTCTTTCCCTCCCCGTACTTGCCGCCGGCATCACAATGCTTTTAACAGACCGAAACCTTAACACCACCTTCTTTGACCCTGCCGGAGGAGGAGACCCAATCCTTTACCAACACCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cottus perplexus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Reasons: Apparently secure in Washington and Oregon, uncommon at range periphery in California.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
NatureServe

Reviewer/s
Smith, K. & Darwall, W.R.T.

Contributor/s

Justification
Listed as Least Concern in view of the large extent of occurrence, large number of subpopulations, large population size, apparently stable trend, and lack of major threats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Trend over the past 10 years or three generations is uncertain but likely relatively stable.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is represented by a large number of occurrences (subpopulations).

Total adult population size is unknown but apparently quite large (likely greater than 100,000).

Trend over the past 10 years or three generations is uncertain but likely relatively stable.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: C : Not very threatened throughout its range, communities often provide natural resources that when exploited alter the composition and structure over the short-term, or communities are self-protecting because they are unsuitable for other uses

Comments: No major threats are known. Locally, this species may be negatively affected by poor water quality and dams.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
No major threats are known. Locally, this species may be negatively affected by poor water quality and dams.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Global Protection: None. No occurrences appropriately protected and managed

Needs: Alert responsible agencies of management needs for California populations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation Actions

Conservation Actions
Survey all California tributaries of the Rogue River to determine extent of distribution. Alert responsible agencies of management needs for California populations.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Previously synonymized with C. gulosus; resurrected as a distinct species by Robins and Miller (1957); morphology indicates that perplexus is more closely allied to C. klamathensis than to C. gulosus. Formerly included in the order Perciformes; the 1991 AFS checklist (Robins et al. 1991) followed Nelson (1984) in recognizing the order Scorpaeniformes as distinct from the Perciformes.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!