Overview

Comprehensive Description

Biology

There appears to be two genetically distinct forms (Ref. 27547), an inland form found in sandy and rocky shores of lakes, and a coastal form usually found over sand in quiet runs of small to medium rivers; sometimes in salt water near river mouths (Ref. 2850). The coastal form moves into brackish estuaries to spawn (Ref. 27547). Oviparous with demersal, adhesive eggs and pelagic larvae (Ref. 265). Feed mainly on aquatic insect larvae and bottom invertebrates (Ref. 1998). Too small to be used as food and too difficult to capture in large numbers to be used for anything else (Ref. 27547) but large individuals are reported to be excellent eating as well as good bait fishes (Ref. 2850).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Range encompasses Pacific Slope drainages of North America from Ventura River, California, to the Kenai Peninsula, Alaska; east of the Continental Divide, this sculpin occurs in the upper Peace River (Arctic basin), British Columbia; it occurs on Queen Charlotte and Vancouver islands (Lee et al. 1980, Page and Burr 2011).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Range encompasses Pacific Slope drainages of North America from Ventura River, California, to the Kenai Peninsula, Alaska; east of the Continental Divide, this sculpin occurs in the upper Peace River (Arctic basin), British Columbia; it occurs on Queen Charlotte and Vancouver islands (Lee et al. 1980, Page and Burr 2011).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North America: Pacific slope drainages from Seward, Alaska to Ventura River, California, USA; also east of Continental Divide in upper Peace River in British Columbia, Canada. Exhibits coastal and inland forms that are genetically distinct (Ref. 27547).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern North Pacific: Seward, Alaska, to Ventura River, southern California, U.S.A.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 7 - 10; Dorsal soft rays (total): 18 - 23; Analspines: 0; Analsoft rays: 15 - 19; Vertebrae: 34 - 39
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 9 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Maximum size: 300 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

30.0 cm TL (male/unsexed; (Ref. 5723)); max. reported age: 7 years (Ref. 28210)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Distinguished by a complete lateral line, a single pore at the tip of the chin, the presence of 15 to 19 anal rays, and well developed palatine teeth (Ref. 27547). Pectorals large and fan-shaped; caudal truncate or slightly rounded (Ref. 27547). Dark brown, olive or gray above and on sides, whitish yellow to white below; usually three dark irregular blotches or bars below soft dorsal; vague irregular dark mark on sides; fins (except anal) have dark bars, the first dorsal with a dark spot towards the rear (Ref. 27547). Both sexes show an orange band on the edge of the first dorsal fin at spawning time (Ref. 27547). The inland form is generally more densely prickled over a larger portion of the body while the coastal form shows a reduced number of prickles (Ref. 28211).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Comments: Habitat includes coastal and inland streams and sandy and rocky shores of lakes. Typically this sculpin inhabits pools and waters of slight current in small to medium rivers and is often on bottoms of fine materials, predominantly sand (Lee et al. 1980). It also occurs in tidewater areas; it can tolerate brackish water (tidepools, estuaries). Spawning occurs in freshwater or intertidal zones that contain flat rocks and moderate current. Males prepare nests under rocks, logs, cans, car bodies, or other debris. Larvae are pelagic for 30-35 days.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Habitat includes coastal and inland streams and sandy and rocky shores of lakes. Typically this sculpin inhabits pools and waters of slight current in small to medium rivers and is often on bottoms of fine materials, predominantly sand (Lee et al. 1980). It also occurs in tidewater areas; it can tolerate brackish water (tidepools, estuaries). Spawning occurs in freshwater or intertidal zones that contain flat rocks and moderate current. Males prepare nests under rocks, logs, cans, car bodies, or other debris. Larvae are pelagic for 30-35 days.

Systems
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

demersal; catadromous (Ref. 51243); freshwater; brackish; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 8 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0.05 - 6

Graphical representation

Depth range (m): 0.05 - 6
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Downstream migration of adults and upstream migration of young-of-the-year sculpins is typical of many (but not all) populations (Moyle 1976).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Catadromous. Migrating from freshwater to the sea to spawn, e.g., European eels. Subdivision of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Comments: Feeds mainly on aquatic insects, their larvae, and other large benthic invertebrates. Larger sculpins (> 70 mm SL) often eat fishes.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

There appears to be two genetically distinct forms (Ref. 27547), an inland form found in sandy and rocky shores of lakes, and a coastal form usually found over sand in quiet runs of small to medium rivers; sometimes in salt water near river mouths (Ref. 2850). The coastal form moves into brackish estuaries to spawn (Ref. 27547). Feed mainly on aquatic insect larvae and bottom invertebrates (Ref. 1998). Juvenile and adults feed mainly on insects (Ref. 13348).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 - 300

Comments: This species is represented by a large number of occurrences (subpopulations).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

100,000 to >1,000,000 individuals

Comments: Total adult population size is unknown but apparently quite large. This sculpin is common; locally abundant (Page and Burr 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Abundant where found (Moyle 1976).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Typically hides under submerged objects during the day, emerges and feeds actively at night. Moves to deeper water during the winter and lives under cover of rocks and other debris (Wydoski and Whitney 1979)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Prior to breeding, males move downstream and select a nesting site under boulders or flat rocks. Females aggregate some distance upstream and move down singly to the spawning area. Courtship behavior occurs outside the nest until a female is selected. The pair enter the nesting site, courting continues until eggs are deposited and fertilized. The female then leaves the nest and goes back upstream to feed, while the male spawns with other females or fans and guards the eggs. The male does not feed until the eggs have hatched, moving upstream only in the late summer (Ref. 1998, 27547). During the planktonic stage, larvae of the freshwater nonanadromous form in lakes show distinct diurnal vertical migrations, being most abundant at the surface during the darkest hours of the night. They apparently stay deep in the water during the day and on bright moonlight nights (Ref. 28920). Metamorphosis is complete by the end of the planktonic period and the young take up a demersal mode of life. The young coastal form may move upstream during the fall, although the young may remain in the estuary for a full year (Ref. 27547).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Matures in 2nd-4th year. Spawning may occur late February-June; most spawning in California probably occurs March-April. Female deposits 280- 11,000 eggs depending on her size and age (Moyle 1976). Male may spawn with more than one female.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cottus asper

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTGGCACCCTATATCTAGTATTTGGTGCTTGAGCCGGAATAGTAGGCACAGCCTTAAGCCTCCTAATTCGAGCAGAACTAAGCCAACCCGGCGCCCTTTTGGGGGACGACCAGATTTATAATGTAATTGTTACGGCCCATGCTTTCGTAATAATTTTCTTTATAGTAATACCAATTATAATCGGGGGTTTCGGGAACTGACTCATCCCCCTAATGATCGGCGCCCCTGATATGGCCTTTCCTCGAATAAACAATATGAGCTTTTGACTTCTTCCCCCATCTTTTTTACTCCTCCTAGCCTCTTCGGGGGTCGAAGCAGGAGCGGGAACCGGATGAACAGTTTACCCACCCCTCGCCGGGAACCTCGCCCATGCAGGAGCCTCTGTTGACCTAACGATCTTCTCCCTTCACCTAGCAGGTATCTCTTCTATTCTTGGAGCAATCAACTTTATCACAACTATCATTAATATGAAACCCCCTGCTATTTCTCAATACCAGACCCCTCTATTCGTATGGTCTGTTCTTATTACTGCTGTCCTACTGCTTCTTTCCCTCCCCGTACTTGCCGCCGGCATCACAATGCTCCTAACAGACCGAAACCTTAACACCACCTTCTTTGACCCTGCCGGAGGAGGAGACCCAATCCTTTACCAACACCTCTTTTGATTCTTCGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Cottus asper

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4 - Apparently Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
NatureServe

Reviewer/s
Smith, K. & Darwall, W.R.T.

Contributor/s

Justification
This species is listed as Least Concern in view of the fairly large extent of occurrence, large number of subpopulations, and large population size, and because the species is probably not declining fast enough to qualify for any of the threatened categories.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Trend over the past 10 years or three generations is uncertain but likely relatively stable.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is represented by a large number of occurrences (subpopulations).

Total adult population size is unknown but apparently quite large. This sculpin is common; locally abundant (Page and Burr 1991).

Trend over the past 10 years or three generations is uncertain but likely to be relatively stable.


Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Comments: No major threats are known. Locally, some populations likely have been eliminated or reduced as a result of barriers constructed across streams (Moyle 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
No major threats are known. Locally, some populations have probably been eliminated or reduced as a result of barriers constructed across streams (Moyle 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Currently, this species is of relatively low conservation concern and does not require significant additional protection or major management, monitoring, or research action.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: public aquariums; bait: occasionally
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Cottus asper

Cottus asper is a species of fish in the sculpin family known by the common name prickly sculpin. It is native to the river drainages of the Pacific Slope of North America from Seward, Alaska south to the Ventura River of Southern California. It extends east of the Continental Divide in the Peace River of British Columbia. It has also been introduced to several reservoirs in Southern California.[1]

Contents

Description [edit]

This fish can reach about 30 centimeters in length,[1] but it is usually smaller, often around 7 centimeters.[2] It is mature at 2 to 4 years of age,[3] and its maximum lifespan is around 7 years.[2] It is brown, gray, or olive green on its upper parts and white or yellowish ventrally. There are dark spots or bars on the back and dark bars on most of the fins.[2] The breeding male is darker in color than the female and nonbreeding male.[4] Both sexes develop an orange coloration along the edge of the first dorsal fin during breeding. The pectoral fins are large and fan-shaped. The body of the fish is prickly; inland-dwelling fish tend to be more prickly than those at the coast.[2]

Biology [edit]

There are two main forms of the species. The inland form lives in lakes, while the coastal form lives in rivers and swims down into brackish estuaries to breed. A catadromous species, it is tolerant of high and low salinities. It is generally a bottom-dwelling species.[2] It is nocturnal, feeding at night.[3]

The diet of the fish includes water invertebrates, insects and their larvae,[3] salmon eggs,[1] fish larvae, especially those of the Sacramento sucker (Catostomus occidentalis occidentalis), and zooplankton, especially Daphnia spp.[5] Larger sculpins eat small fish,[3] frogs, and molluscs.[6] The adults are known to cannibalize the juveniles.[7]

In its habitat it lives alongside its relative, the coastrange sculpin (Cottus aleuticus), which is quite similar to it in terms of morphology and behavior.[8][9] It can also be found with the three-spined stickleback (Gasterosteus aculeatus), steelhead trout (Onchorhynchus mykiss),[7] Klamath small-scale sucker (Catostomus rimiculus), coastal cutthroat trout (Oncorhynchus clarki clarki), Chinook salmon (O. tshawytscha), and coho salmon (O. kisutch).[9]

Spawning season can extend from February to June. The male creates a nest under debris such as logs or garbage, and the female lays many eggs, from a few hundred up to 11,000.[3] The male guards the nest.[10] He may breed with more than one female per season.[3]

Range [edit]

This fish is common in most of its range, becoming quite abundant in the summer when recruitment occurs and the previous season's juveniles join the population.[7] While it is native to many waterways in California, it represents an introduced species in some Southern California lakes, rivers, and tributaries, such as the Santa Clara River, the Santa Ana River, Irvine Lake, and Big Bear Lake. It occurs in reservoirs such as Pyramid Lake. It was likely introduced to many of these places from farther north via the California Aqueduct.[1]

Uses [edit]

The fish is said to be edible by humans, at least the larger individuals. It also makes a good bait fish.[2]

References [edit]

  1. ^ a b c d Fuller, P. and M. Neilson. 2013. Cottus asper. USGS Nonindigenous Aquatic Species Database, Gainesville, FL.
  2. ^ a b c d e f Froese, R. Cottus asper. In: Froese, R. and D. Pauly. Editors. 2011. FishBase. World Wide Web electronic publication.
  3. ^ a b c d e f NatureServe. 2013. Cottus asper. NatureServe Explorer: An Online Encyclopedia of Life [web application].
  4. ^ Rickard, N. A. (1980). Life history and population characteristics of the prickly sculpin (Cottus asper Richardson) in Lake Washington. (Thesis). University of Washington.
  5. ^ Merz, J. E. (2002). Comparison of diets of prickly sculpin and juvenile fall-run Chinook salmon in the lower Mokelumne River, California. The Southwestern Naturalist 47(2) 195-204.
  6. ^ Cottus asper. California Fish Website. University of California.
  7. ^ a b c Pfister, C. A. (2003). Some consequences of size variability in juvenile prickly sculpin, Cottus asper. Environmental Biology of Fishes 66 383-90.
  8. ^ Brown, L. R., et al. (1995). Comparative ecology of prickly sculpin, Cottus asper, and coastrange sculpin, Cottus aleuticus, in the Eel River, California. Environmental Biology of Fishes 42 329-43.
  9. ^ a b White, J. L. and B. C. Harvey. (1999). Habitat separation of prickly sculpin, Cottus asper, and coastrange sculpin, Cottus aleuticus, in the mainstem Smith River, northwestern California. Copeia 2 371-75.
  10. ^ Prickly Sculpin, Cottus asper. Marine Species with Aquaculture Potential Off the Coast of Oregon and Pacific Northwest.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Early nomenclatural history confusing. Two forms, a sparsely prickled coastal form and heavily prickled inland form, have been recognized and may be genetically distinct (Lee et al. 1980). Formerly included in the order Perciformes; the 1991 AFS checklist (Robins et al. 1991) followed Nelson (1984) in recognizing the order Scorpaeniformes as distinct from the Perciformes.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!