Overview

Comprehensive Description

Description

  Common names: sandab (English), lenguado (Espanol)
 
Citharichthys stigmaeus Jordan & Gilbert, 1882


Speckled sanddab


Body elongate; head < 30% of SL; eyes on left side; lower eye diameter equal to or less than snout length; narrow and flat between eyes, no bony ridge over lower eye; mouth medium length, ends under center of lower eye; blind side jaws not arched; teeth ~ equally developed on both sides of jaws, in 1 series of immovable teeth on each jaw, no canines but front teeth a little enlarged; gill rakers slender, short, 8-10 lower rakers; 75-97 dorsal rays; 58-77 anal rays; eye side pectoral 43-59% of head length, not reaching eye when folded forwards; base of eye side pelvic on midline of body; tail fin rounded; urinary papilla on blind side, immediately behind anus; eye-side lateral line ~ straight, from edge of opercle to tail base; scales rough,  52-58 lateral line scales.

Eye-side tan to olive; finely and sharply speckled with black on body and fins; 3 dark blotches on body along lateral line; blind-side cream.

Size: 19 cm.

Habitat: sandy bottoms.

Depth: 0-366 m.

Alaska to southern Baja.   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Found on sandy bottom, from near shore to 366 m (Ref. 2850). Little commercial importance because of its small size (Ref. 2850).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, East Pacific endemic, TEP non-endemic

Regional Endemism: All species, Tropical Eastern Pacific (TEP) non-endemic, Temperate Eastern Pacific, primarily, California province, primarily, Continent, Continent only

Residency: Vagrant

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific: Montague Island, Alaska to Bahia Magdalena, southern Baja California, Mexico.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern North Pacific: Alaska to Baja California.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth

Depth Range (m): 0 (S) - 366 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 75 - 97; Analspines: 0; Analsoft rays: 58 - 77; Vertebrae: 34 - 39
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length max (cm): 19.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 170 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

17.0 cm TL (male/unsexed; (Ref. 2850))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Caudal rounded.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Citharichthys stigmaeus
Catalog Number: USNM 31099
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Radiograph
Collector(s): A. Larco
Locality: Santa Barbara, Santa Barbara County, California, United States, Pacific
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; marine; depth range ? - 549 m (Ref. 27436), usually ? - 91 m (Ref. 2850)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 147 specimens in 1 taxon.
Water temperature and chemistry ranges based on 71 samples.

Environmental ranges
  Depth range (m): 0.38 - 156
  Temperature range (°C): 7.150 - 25.936
  Nitrate (umol/L): 0.616 - 27.466
  Salinity (PPS): 32.069 - 35.213
  Oxygen (ml/l): 3.157 - 6.134
  Phosphate (umol/l): 0.364 - 2.261
  Silicate (umol/l): 3.320 - 43.852

Graphical representation

Depth range (m): 0.38 - 156

Temperature range (°C): 7.150 - 25.936

Nitrate (umol/L): 0.616 - 27.466

Salinity (PPS): 32.069 - 35.213

Oxygen (ml/l): 3.157 - 6.134

Phosphate (umol/l): 0.364 - 2.261

Silicate (umol/l): 3.320 - 43.852
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 549m.
Recorded at 549 meters.

Habitat: demersal. Found on sandy bottoms. Preyed upon by fishes, marine mammals and sea birds. Of no commercial importance due to its small size (Ref. 6885).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Bottom, Bottom only

Habitat: Soft bottom (mud, sand,gravel, beach, estuary & mangrove), Soft bottom only, Sand & gravel

FishBase Habitat: Demersal
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Feeding

Feeding Group: Carnivore

Diet: mobile benthic worms, mobile benthic crustacea (shrimps/crabs), bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Citharichthys stigmaeus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTGGCACCCTTTATCTCGTATTTGGTGCCTGAGCCGGCATGGTCGGGACGGCCCTGAGCCTACTCATCCGGGCCGAACTCAGTCAACCAGGAGCTCTCCTGGGGGACGACCAAATTTATAATGTTATCGTTACGGCACATGCTTTCGTAATAATCTTCTTTATAGTAATACCCATTATGATTGGGGGCTTTGGAAACTGATTAATTCCTCTAATGATTGGGGCGCCAGATATGGCATTCCCACGAATGAACAACATGAGCTTCTGACTGCTCCCTCCCTCTTTTCTATTACTCTTGGCTTCTTCAGGGGTAGAAGCAGGTGCCGGTACAGGATGAACGGTTTATCCGCCATTAGCGGGCAACCTAGCTCACGCTGGGGCATCCGTTGACCTTACCATCTTCTCCCTCCATCTTGCAGGGATTTCTTCTATCCTAGGGGCCATTAATTTTATCACAACTATTATTAACATGAAACCCAACTCCGTCACAATGTATCAAATCCCCCTTTTCGTATGAGCCGTTCTTATCACTGCTGTATTACTACTACTTTCCCTTCCAGTTCTAGCCGCGGGTATTACCATGCTATTAACAGACCGAAACTTGAATACCACCTTCTTTGACCCGGCAGGAGGTGGAGACCCAATTCTTTACCAACACCTGTTCTGATTCTTCGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Citharichthys stigmaeus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; price category: very high; price reliability: unreliable: based on ex-vessel price for species in this order
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Speckled sanddab

The Speckled sanddab (Citharichthys stigmaeus) is a species of flounder in the genus Citharichthys. It is native to the eastern Pacific Ocean, ranging from Alaska in the north to Baja California, Mexico in the south.

It is a much smaller cousin of the Pacific sanddab, growing to a maximum of 17 cm in length. It can be found on the sandy bottom near the shore to as far out as 350 m. It is a dull brown or tan colour, with a white or pale brown underside. Males are often mottled with orange spots.

While the speckled sanddab is technically a game fish, it is of little commercial importance due to its diminutive size, and the larger Pacific sanddab is readily available. The species has a high rate of reproduction, and coupled with the minimal threat from fishing means that it is abundant along the entire North American coast.

The Speckled Sanddab eats small crustaceans and its predators are fish, birds and marine mammals. The fish can camouflage itself by adapting to look like the surface it is on.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!