Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Inhabits coastal rocky reefs (Ref. 43239). Benthopelagic (Ref. 58302). Juveniles associate with drifting seaweed (Ref. 12114, 12115, 58302).
  • Nakabo, T. 2002 Fishes of Japan with pictorial keys to the species, English edition II. Tokai University Press, Japan, pp 867-1749. (Ref. 43239)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Northwest Pacific: Japan, Korea, Taiwan. Eastern Central Pacific: Hawaii.
  • Nakabo, T. 2002 Fishes of Japan with pictorial keys to the species, English edition II. Tokai University Press, Japan, pp 867-1749. (Ref. 43239)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western and Central North Pacific: Japan, Ogasawara Islands, Hawaiian Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 800 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

80.0 cm TL (male/unsexed; (Ref. 559)); max. published weight: 6,400 g (Ref. 40637)
  • IGFA 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA. (Ref. 40637)
  • Masuda, H., K. Amaoka, C. Araga, T. Uyeno and T. Yoshino 1984 The fishes of the Japanese Archipelago. Vol. 1. Tokai University Press, Tokyo, Japan. 437 p. (text). (Ref. 559)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 1 - 10 m (Ref. 58302)
  • Mundy, B.C. 2005 Checklist of the fishes of the Hawaiian Archipelago. Bishop Museum Bulletins in Zoology. Bishop Mus. Bull. Zool. (6):1-704. (Ref. 58302)
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 30 - 30
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Oplegnathus fasciatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACACGTTGATTTTACTCGACTAATCACAAAGACATCGGCACCCTCTATCTAGTATTTGGTGCCCGAGCCGGCATAGTAGGCACGGCCCTAAGCTTACTCATCCGAGCAGAACTAAGCCAACCAGGCGCTTTCCTCGGAGAC---GACCAGATCTATAATGTAATTGTTACAGCACATGCCTTCGTAATAATCTTCTTTATAGTAATGCCAATTATGATTGGAGGTTTTGGAAACTGACTCATCCCCCTCATGATTGGTGCGCCAGACATGGCATTTCCTCGAATAAATAACATGAGCTTTTGACTGCTCCCACCCTCTTTCTTGCTACTGCTGGCCTCTTCCGGAGTAGAAGCTGGAGCAGGCACCGGATGAACCGTTTATCCGCCTCTCGCAGGTAATTTAGCCCATGCAGGAGCGTCTGTTGATTTAACAATCTTCTCTCTACACTTAGCAGGTATTTCCTCAATCCTCGGGGCAATCAACTTTATTACAACTATTATTAACATGAAACCCCCTGCCATTTCCCAATATCAAACCCCACTATTTGTGTGAGCAGTCCTAATTACTGCTGTTCTACTTCTCCTTTCCCTCCCCGTTCTCGCTGCTGGCATCACCATGCTCCTAACAGACCGAAACCTAAATACCACCTTTTTTGACCCTGCAGGAGGAGGAGACCCCATCCTTTACCAACACCTCTTCTGATTTTTCGGACATCCGGAAGTCTATATCCTGATTCTTCCAGGGTTTGGTATAATTTCACACATCGTTGCTTACTACTCTGGTAAAAAAGAACCCTTCGGCTATATAGGCATGGTCTGAGCTATGATGGCAATTGGCCTTCTAGGATTTATTGTTTGAGCCCACCATATGTTCACAGTTGGAATGGATGTTGACACACGCGCCTACTTTACATCCGCCACTATAATTATTGCAATCCCCACAGGTGTAAAAGTCTTTAGCTGACTTGCAACCCTTCATGGAGGA---GCA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Oplegnathus fasciatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquaculture: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Striped beakfish

Oplegnathus fasciatus, the barred knifejaw or striped beakfish, is a species of knifejaw native to the northwestern Pacific Ocean though there area a smattering of records from other localities in the eastern Pacific such as Hawaii and Chile. It is an inhabitant of rocky reefs and occurs at depths of from 1 to 10 metres (3.3 to 32.8 ft). Juvenile members of this species can be found with patches of drifting seaweed. This species can reach a length of 80 centimetres (31 in) TL with the greatest recorded weight for this species of 6.4 kilograms (14 lb). The color pattern consists of light and dark vertical bars from which it derives its name. It has been recorded as feeding on hard-shelled invertebrates such as crustaceans and molluscs. It is a commercially important species and is also farmed. It is also sought after as a game fish.[1] A striped beakfish is the surviving specimen of five striped beakfish that endured more than two years in the partially submerged hull of the Japanese boat Sai-shou-maru.[2][3]

References[edit]

  1. ^ Froese, Rainer and Pauly, Daniel, eds. (2014). "Oplegnathus fasciatus" in FishBase. February 2014 version.
  2. ^ Japanese 'tsunami fish' hitches ride to US
  3. ^ The Fish that Travelled 10000 Kilometres
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!