Overview

Comprehensive Description

Biology

A common inshore bottom shark (Ref. 247). Often found in estuaries (Ref. 4832). Probably feeds mainly on invertebrates (Ref. 247, 43278). Oviparous (Ref. 43278, 50449). Utilized as a food fish (Ref. 171).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

An Indo-West Pacific species. Occurs at depths of 5 to 80 m in inshore areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific: Arabian Sea to Pakistan, India, Malaysia, Thailand, Indonesia, China, Japan, the Philippines, Papua New Guinea. Probably occurring in Sri Lanka (Ref. 13575). Many records need confirmation (Ref. 13575).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific: Arabian Sea to New Guinea, north to southern Japan.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 740 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

74.0 cm TL (male/unsexed; (Ref. 247))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Genus: Nostrils subterminal on snout; pre-oral snout long, mouth closer to eyes than snout tip; eyes and supraorbital ridges hardly elevated; no black hood on head or large spot or spots on sides of body above pectoral fins (Ref. 43278). Caudal fin with a pronounced subterminal notch but without a ventral lobe (Ref. 13575). Species: Light brown, yellow-brown or grey-brown above, cream below, with 12-13 prominent saddle marks in young, fading with growth and absent in adults (Ref. 13575). Dark bands in juveniles not outline in black (Ref. 13575). Dorsal fins smaller than pelvic fins, without projecting free rear tips (Ref. 13575). Body without lateral dermal ridge (Ref. 4832,43278, 13575).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
A common, sluggish inshore bottom dweller, found on sandy and muddy bottoms, on rocks and in coral lagoons at depths from 5 to 80 m. Oviparous, deposits eggs in small oval egg cases on the bottom. Feeds mainly on small fish, shrimps, worms, molluscs and crabs. Maximum total length at least 77 cm. Free-living individuals have been found at sizes of at least 12.2 cm, size at hatching uncertain; males maturing between 45 and 55 cm.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; oceanodromous (Ref. 51243); brackish; marine; depth range 5 - 80 m (Ref. 43278)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 3 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 38.4 - 91.4
  Temperature range (°C): 24.022 - 27.590
  Nitrate (umol/L): 0.954 - 7.089
  Salinity (PPS): 34.202 - 34.546
  Oxygen (ml/l): 3.436 - 4.381
  Phosphate (umol/l): 0.177 - 0.683
  Silicate (umol/l): 2.202 - 4.739

Graphical representation

Depth range (m): 38.4 - 91.4

Temperature range (°C): 24.022 - 27.590

Nitrate (umol/L): 0.954 - 7.089

Salinity (PPS): 34.202 - 34.546

Oxygen (ml/l): 3.436 - 4.381

Phosphate (umol/l): 0.177 - 0.683

Silicate (umol/l): 2.202 - 4.739
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, deposits eggs in small, oval eggs cases on the bottom (Ref. 247). Paired eggs are laid. Embryos feed solely on yolk (Ref. 50449). Distinct pairing with embrace (Ref. 205). During copulation observed in captivity, the male bites the female's pectoral fin in a side-to-side position (Ref. 49562, 51121).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chiloscyllium griseum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCAATTAATCGTTGACTATTTTCTACAAACCACAAAGATATCGGCACCCTTTATTTAATCTTCGGTGCATGAGCAGGAATAGTAGGTATAGCTCTTAGCCTCTTAATTCGTGCTGAACTAAGTCAACCTGGGTCCCTTCTAGGTGATGACCAGATTTATAATGTAATCGTAACAGCTCATGCTTTCGTAATAATCTTCTTTATGGTAATGCCTGTAATAATTGGTGGATTTGGAAATTGACTAGTACCCCTGATAATCGGCGCACCTGATATAGCTTTTCCTCGAATAAACAATATAAGCTTTTGATTACTTCCCCCTTCATTCTTATTACTCTTAGCCTCTGCAGGAGTTGAAGCTGGGGCAGGAACAGGCTGAACTGTCTACCCACCTTTAGCAGGTAATTTAGCACATGCAGGAACATCAGTTGATCTAACTATTTTCTCCCTACACTTAGCAGGAATCTCATCAATTTTAGCCTCTATTAATTTTATCACAACTATCATTAATATAAAACCACCAGCAATTTCTCAATATCAAACACCTCTATTTGTTTGATCCATCCTTGTAACTACTATTCTTCTACTACTTTCATTACCTGTTTTAGCAGCAGGCATTACAATGTTACTTACAGACCGAAACTTAAATACAACATTCTTTGATCCAGCAGGAGGAGGCGATCCTATTCTATATCAACACCTATTCTGATTCTTTGGACACCCAGAAGTATATATTTTAATCCTTCCAGGATTTGGTATAATTTCACATGTAGTTGCTTATTATTCAGGTAAAAAAGAACCTTTTGGATATATAGGAATAGTTTGAGCTATAATAGCAATTGGCTTATTAGGCTTTATTGTTTGAGCCCATCACATATTTACAGTAGGAATAGACGTTGACACACGAGCTTACTTCACATCTGCAACAATAATTATTGCAATTCCTACAGGAGTTAAAGTATTTAGCTGATTAGCAACACTCCATGGTGGTTCAATTAAATGAGAAACACCCATACTATGAGCTTTAGGTTTTATTTTCCTATTTACTGTTGGAGGCCTAACAGGAATTGTACTAGCTAATTCATCATTAGATATTGTTCTCCATGATACTTATTATGTAGTAGCTCATTTCCATTATGTTCTCTCTATAGGAGCAGTTTTCGCTATTATAGCAGGTTTCATCCATTGATTCCCACTAATTTCAGGCTTTACCTTACACTCTACCTGAACAAAAATCCAATTCATCTTAATGTTTATCGGAGTAAATTTAACTTTCTTCCCCCAACATTTTCTCGGACTTGCTGGGATACCACGACGATATTCAGACTATCCTGATGCCTATACCCTATGAAATACCATTTCCTCAATTGGCTCACTAATTTCATTAGTAGCAGTAATTCTCTTACTATTTATTATCTGAGAAGCATTTGCTTCCAAACGAGAAGTATTATCCATTGAACTCCCACACACAAACGTAGAGTGACTTCATGGATGCCCTCCCCCATATCATACTTATGAAGAACCTGCTTTTGTTCAAGTTCAACGAACTTCATTTTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Chiloscyllium griseum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2003

Assessor/s
Lisney, T.J. & Cavanagh, R.D. (SSG Australia & Oceania Regional Workshop, March 2003)

Reviewer/s
Shark Specialist Group Australia & Oceania Regional Group (Shark Red List Authority)

Contributor/s

Justification
The reproductive and population biology of this small inshore species is poorly known, and it fails to meet any of the criteria for Vulnerable due to insufficient data. However, this species is assessed as Near Threatened as it is regularly taken in fisheries off Pakistan, India and Thailand, and is likely to be threatened by population decline resulting from overfishing, destructive fishing practices and habitat modification, including the damage and destruction of coral reefs. Such threats are likely to increase in the future; there is a need for survey and appraisal of the status of this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There is no information on population size.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Regularly taken in inshore fisheries off Pakistan, India and Thailand, and utilized for human food, and is likely to be threatened by overfishing, destructive fishing practices and habitat modification, including the damage and destruction of coral reefs throughout much of its range. This species is kept in public aquaria in the United States (Compagno 2001) but apparently rare in the aquarium trade (Michael 2001).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Near Threatened (NT)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no conservation measures currently in place for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Grey bamboo shark

The grey bamboo shark, Chiloscyllium griseum, is a species of carpet shark in the family Hemiscylliidae, found in the Indo-West Pacific Oceans from the Arabian Sea to Pakistan, India, Malaysia, Thailand, Indonesia, China, Japan, the Philippines, and Papua New Guinea, between latitudes 34° N and 10° S, and longitude 60° E and 150° E. Its length is up to 74 cm.[2][3]

Features: Adults are brown and have no coloration but the juveniles have transverse dark bands.[4]

Reproduction is Oviparous (egg laying).

Classified as Near Threatened (NT) on the IUCN Red List[5]

See also[edit]

References[edit]

  1. ^ Lisney, T.J. and R.D. Cavanagh (2003). Chiloscyllium griseum. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved January 11, 2009.
  2. ^ Froese, Rainer and Pauly, Daniel, eds. (2010). "Chiloscyllium griseum" in FishBase. January 2010 version.
  3. ^ Compagno, L.J.V., M. Dando and S. Fowler (2005). Sharks of the World. Princeton University Press. ISBN 0-691-12072-2. 
  4. ^ Compagno, Leonard. "Sharks of the world." Shark Research Center Iziko-Museums of Cape Town. NO. 1. Vol 2. Cape Town South Africa: FOOD AND AGRICULTURE ORGANIZATION OF THE UNITED NATIONS, 2002. Pg 169
  5. ^ unknown, . "Chiloscyllium punctatum." International Union for Conservation of Nature and Natural Resources. N.p., 2010. Web. 15 April 2010.<unknown, . "Chiloscyllium punctatum." International Union for Conservation of Nature and Natural Resources. N.p., 2010. Web. 15 April 2010./>
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!