Overview

Comprehensive Description

Biology

Found on soft bottoms (Ref. 2850).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North Pacific: Komandorski Island and Avachin Bay, Russia through the Aleutian chain to north of St. Mathew Island in the Bering Sea (Ref. 6793) and Eureka, northern California, USA.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North Pacific: northern Bering Sea to Pacific coast of northern Japan and northern California.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 6 - 8; Dorsal soft rays (total): 6 - 7; Analspines: 0; Analsoft rays: 7 - 9
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 210 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

24.2 cm TL (male/unsexed; (Ref. 56575)); max. reported age: 9 years (Ref. 56575)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Caudal rounded; lower 4 or 5 rays of pectorals thicker but membrane reaching nearly to ends; pelvic fins reduced (Ref. 6885). Light brown on dorsal surface, dusky light brown on ventral surface; dark blue on ventral surface of head; all fins very dark (Ref. 6885).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; marine; depth range 18 - 1290 m (Ref. 50610), usually 400 - 700 m (Ref. 56575)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 266 specimens in 1 taxon.
Water temperature and chemistry ranges based on 62 samples.

Environmental ranges
  Depth range (m): 39.5 - 872.91
  Temperature range (°C): 2.984 - 8.274
  Nitrate (umol/L): 17.905 - 46.171
  Salinity (PPS): 32.966 - 34.288
  Oxygen (ml/l): 0.673 - 4.614
  Phosphate (umol/l): 1.713 - 3.277
  Silicate (umol/l): 28.547 - 142.010

Graphical representation

Depth range (m): 39.5 - 872.91

Temperature range (°C): 2.984 - 8.274

Nitrate (umol/L): 17.905 - 46.171

Salinity (PPS): 32.966 - 34.288

Oxygen (ml/l): 0.673 - 4.614

Phosphate (umol/l): 1.713 - 3.277

Silicate (umol/l): 28.547 - 142.010
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 18 - 1248m.
From 18 to 1248 meters.

Habitat: demersal. Occurs on soft bottoms.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bathyagonus nigripinnis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTGGCACCCTCTATCTAGTATTTGGTGCTTGAGCCGGAATAGTAGGCACAGCCCTAAGCCTCCTAATTCGAGCTGAGCTGAGCCAACCCGGGGCCCTCTTAGGGGACGACCAGATTTATAATGTAATTGTTACGGCCCATGCTTTCGTAATAATCTTCTTTATAGTAATACCAATCATAATCGGGGGTTTCGGAAACTGACTTGTCCCTCTAATGATCGGCGCCCCCGATATGGCATTTCCTCGAATAAACAACATGAGCTTTTGACTCCTCCCTCCCTCCTTTTTATTACTCCTCGCCTCCTCCGGAGTAGAAGCCGGGGCCGGGACGGGGTGGACAGTCTATCCCCCTCTCGCTGGGAATCTAGCACATGCGGGAGCCTCTGTTGATCTCACAATCTTCTCTTTACATTTAGCAGGGATCTCTTCAATCCTTGGGGCAATTAATTTCATCACAACAATCATCAACATGAAGCCTCCTGCTATTTCTCAATACCAGACCCCCCTTTTCGTATGATCTGTTCTCATCACGGCCGTCTTACTACTCCTCGCCCTTCCAGTCCTTGCTGCCGGCATTACAATGCTTTTAACAGACCGTAATCTTAACACCACCTTCTTTGACCCAGCTGGGGGCGGAGACCCCATCCTCTACCAACACCTCTTTTGATTCTTCGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Bathyagonus nigripinnis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Blackfin poacher

The Blackfin poacher (Bathyagonus nigripinnis, also known as the Blackfin starsnout poacher in the United States[1]) is a fish in the family Agonidae (poachers).[2] It was described by Charles Henry Gilbert in 1890.[3] It is a marine, boreal water-dwelling fish which is known from the northern Pacific Ocean, including Komandorski Island and Avachin Bay in Russia, St. Mathew Island in the Bering Sea, and Eureka, California, USA. It dwells at a depth range of 18-1290 metres, most often at around 400-700 m, and inhabits soft bottoms. It is known to live for a maximum of 9 years. Males can reach a maximum total length of 24.2 centimetres, but more commonly reach a TL of 20 cm.[2]

The Blackfin poacher is preyed on by the Sablefish (Anoplopoma fimbria) and the Aleutian skate (Bathyraja aleutica).[4]

References[edit]

  1. ^ Common names for Bathyagonus nigripinnis at www.fishbase.org.
  2. ^ a b Bathyagonus nigripinnis at www.fishbase.org.
  3. ^ Gilbert, C. H., 1890 (1 July) [ref. 1623] A preliminary report on the fishes collected by the steamer Albatross on the Pacific coast of North America during the year 1889, with descriptions of twelve new genera and ninety-two new species. Proceedings of the United States National Museum v. 13 (no. 797): 49-126.
  4. ^ Organisms preying on Bathyagonus nigripinnis at www.fishbase.org.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!